ID: 999072375

View in Genome Browser
Species Human (GRCh38)
Location 5:148759447-148759469
Sequence TCCTGAGATCTCTAGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999072375_999072377 -5 Left 999072375 5:148759447-148759469 CCTGAAATCTAGAGATCTCAGGA No data
Right 999072377 5:148759465-148759487 CAGGAAGGTATTCTTGACTATGG No data
999072375_999072379 -1 Left 999072375 5:148759447-148759469 CCTGAAATCTAGAGATCTCAGGA No data
Right 999072379 5:148759469-148759491 AAGGTATTCTTGACTATGGGTGG No data
999072375_999072378 -4 Left 999072375 5:148759447-148759469 CCTGAAATCTAGAGATCTCAGGA No data
Right 999072378 5:148759466-148759488 AGGAAGGTATTCTTGACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999072375 Original CRISPR TCCTGAGATCTCTAGATTTC AGG (reversed) Intergenic
No off target data available for this crispr