ID: 999072379

View in Genome Browser
Species Human (GRCh38)
Location 5:148759469-148759491
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999072375_999072379 -1 Left 999072375 5:148759447-148759469 CCTGAAATCTAGAGATCTCAGGA No data
Right 999072379 5:148759469-148759491 AAGGTATTCTTGACTATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr