ID: 999074484

View in Genome Browser
Species Human (GRCh38)
Location 5:148781356-148781378
Sequence AGGCTGCTGTGGTATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999074484_999074489 6 Left 999074484 5:148781356-148781378 CCTTCAGCATACCACAGCAGCCT No data
Right 999074489 5:148781385-148781407 AAAGTGGCCAACCTGTTACATGG No data
999074484_999074487 -10 Left 999074484 5:148781356-148781378 CCTTCAGCATACCACAGCAGCCT No data
Right 999074487 5:148781369-148781391 ACAGCAGCCTTATGGAAAAGTGG No data
999074484_999074491 8 Left 999074484 5:148781356-148781378 CCTTCAGCATACCACAGCAGCCT No data
Right 999074491 5:148781387-148781409 AGTGGCCAACCTGTTACATGGGG No data
999074484_999074490 7 Left 999074484 5:148781356-148781378 CCTTCAGCATACCACAGCAGCCT No data
Right 999074490 5:148781386-148781408 AAGTGGCCAACCTGTTACATGGG No data
999074484_999074492 9 Left 999074484 5:148781356-148781378 CCTTCAGCATACCACAGCAGCCT No data
Right 999074492 5:148781388-148781410 GTGGCCAACCTGTTACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999074484 Original CRISPR AGGCTGCTGTGGTATGCTGA AGG (reversed) Intergenic
No off target data available for this crispr