ID: 999074486

View in Genome Browser
Species Human (GRCh38)
Location 5:148781367-148781389
Sequence ACTTTTCCATAAGGCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999074486_999074489 -5 Left 999074486 5:148781367-148781389 CCACAGCAGCCTTATGGAAAAGT No data
Right 999074489 5:148781385-148781407 AAAGTGGCCAACCTGTTACATGG No data
999074486_999074490 -4 Left 999074486 5:148781367-148781389 CCACAGCAGCCTTATGGAAAAGT No data
Right 999074490 5:148781386-148781408 AAGTGGCCAACCTGTTACATGGG No data
999074486_999074491 -3 Left 999074486 5:148781367-148781389 CCACAGCAGCCTTATGGAAAAGT No data
Right 999074491 5:148781387-148781409 AGTGGCCAACCTGTTACATGGGG No data
999074486_999074492 -2 Left 999074486 5:148781367-148781389 CCACAGCAGCCTTATGGAAAAGT No data
Right 999074492 5:148781388-148781410 GTGGCCAACCTGTTACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999074486 Original CRISPR ACTTTTCCATAAGGCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr