ID: 999074491

View in Genome Browser
Species Human (GRCh38)
Location 5:148781387-148781409
Sequence AGTGGCCAACCTGTTACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999074486_999074491 -3 Left 999074486 5:148781367-148781389 CCACAGCAGCCTTATGGAAAAGT No data
Right 999074491 5:148781387-148781409 AGTGGCCAACCTGTTACATGGGG No data
999074484_999074491 8 Left 999074484 5:148781356-148781378 CCTTCAGCATACCACAGCAGCCT No data
Right 999074491 5:148781387-148781409 AGTGGCCAACCTGTTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999074491 Original CRISPR AGTGGCCAACCTGTTACATG GGG Intergenic
No off target data available for this crispr