ID: 999075693

View in Genome Browser
Species Human (GRCh38)
Location 5:148793238-148793260
Sequence CTTGCTTGCTTAGGCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999075693_999075699 27 Left 999075693 5:148793238-148793260 CCATGTGGGCCTAAGCAAGCAAG No data
Right 999075699 5:148793288-148793310 CCTGTCTCAAGGAACCACTGTGG No data
999075693_999075697 16 Left 999075693 5:148793238-148793260 CCATGTGGGCCTAAGCAAGCAAG No data
Right 999075697 5:148793277-148793299 CTTCAGAGAGACCTGTCTCAAGG No data
999075693_999075702 30 Left 999075693 5:148793238-148793260 CCATGTGGGCCTAAGCAAGCAAG No data
Right 999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG No data
999075693_999075700 28 Left 999075693 5:148793238-148793260 CCATGTGGGCCTAAGCAAGCAAG No data
Right 999075700 5:148793289-148793311 CTGTCTCAAGGAACCACTGTGGG No data
999075693_999075701 29 Left 999075693 5:148793238-148793260 CCATGTGGGCCTAAGCAAGCAAG No data
Right 999075701 5:148793290-148793312 TGTCTCAAGGAACCACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999075693 Original CRISPR CTTGCTTGCTTAGGCCCACA TGG (reversed) Intergenic
No off target data available for this crispr