ID: 999075696

View in Genome Browser
Species Human (GRCh38)
Location 5:148793265-148793287
Sequence TCTCTCTGAAGCTTACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999075696_999075705 30 Left 999075696 5:148793265-148793287 CCTTTATGTAAGCTTCAGAGAGA No data
Right 999075705 5:148793318-148793340 AGGAGATTATGCTTTTGACAAGG No data
999075696_999075699 0 Left 999075696 5:148793265-148793287 CCTTTATGTAAGCTTCAGAGAGA No data
Right 999075699 5:148793288-148793310 CCTGTCTCAAGGAACCACTGTGG No data
999075696_999075700 1 Left 999075696 5:148793265-148793287 CCTTTATGTAAGCTTCAGAGAGA No data
Right 999075700 5:148793289-148793311 CTGTCTCAAGGAACCACTGTGGG No data
999075696_999075702 3 Left 999075696 5:148793265-148793287 CCTTTATGTAAGCTTCAGAGAGA No data
Right 999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG No data
999075696_999075703 10 Left 999075696 5:148793265-148793287 CCTTTATGTAAGCTTCAGAGAGA No data
Right 999075703 5:148793298-148793320 GGAACCACTGTGGGGGTTAGAGG No data
999075696_999075701 2 Left 999075696 5:148793265-148793287 CCTTTATGTAAGCTTCAGAGAGA No data
Right 999075701 5:148793290-148793312 TGTCTCAAGGAACCACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999075696 Original CRISPR TCTCTCTGAAGCTTACATAA AGG (reversed) Intergenic
No off target data available for this crispr