ID: 999075702

View in Genome Browser
Species Human (GRCh38)
Location 5:148793291-148793313
Sequence GTCTCAAGGAACCACTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999075693_999075702 30 Left 999075693 5:148793238-148793260 CCATGTGGGCCTAAGCAAGCAAG No data
Right 999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG No data
999075695_999075702 21 Left 999075695 5:148793247-148793269 CCTAAGCAAGCAAGTTGGCCTTT No data
Right 999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG No data
999075696_999075702 3 Left 999075696 5:148793265-148793287 CCTTTATGTAAGCTTCAGAGAGA No data
Right 999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999075702 Original CRISPR GTCTCAAGGAACCACTGTGG GGG Intergenic
No off target data available for this crispr