ID: 999083942

View in Genome Browser
Species Human (GRCh38)
Location 5:148870576-148870598
Sequence CTCCATGTGCTGTAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999083942_999083948 23 Left 999083942 5:148870576-148870598 CCTTCCAGTTACAGCACATGGAG No data
Right 999083948 5:148870622-148870644 ACCACAACCCAAATGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999083942 Original CRISPR CTCCATGTGCTGTAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr