ID: 999086743

View in Genome Browser
Species Human (GRCh38)
Location 5:148898802-148898824
Sequence ATAAGCCAGGAGACCCAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999086735_999086743 24 Left 999086735 5:148898755-148898777 CCAGGCATTCAAGTTTGAGTTGG No data
Right 999086743 5:148898802-148898824 ATAAGCCAGGAGACCCAACTAGG No data
999086734_999086743 25 Left 999086734 5:148898754-148898776 CCCAGGCATTCAAGTTTGAGTTG No data
Right 999086743 5:148898802-148898824 ATAAGCCAGGAGACCCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999086743 Original CRISPR ATAAGCCAGGAGACCCAACT AGG Intergenic
No off target data available for this crispr