ID: 999087222

View in Genome Browser
Species Human (GRCh38)
Location 5:148903657-148903679
Sequence GGGCTAACTCATAAACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999087222_999087224 -6 Left 999087222 5:148903657-148903679 CCCAGCAGTTTATGAGTTAGCCC No data
Right 999087224 5:148903674-148903696 TAGCCCATTTTTTTTCCTTCTGG No data
999087222_999087229 20 Left 999087222 5:148903657-148903679 CCCAGCAGTTTATGAGTTAGCCC No data
Right 999087229 5:148903700-148903722 CCATCTAATAACACCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999087222 Original CRISPR GGGCTAACTCATAAACTGCT GGG (reversed) Intergenic