ID: 999087222 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:148903657-148903679 |
Sequence | GGGCTAACTCATAAACTGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
999087222_999087224 | -6 | Left | 999087222 | 5:148903657-148903679 | CCCAGCAGTTTATGAGTTAGCCC | No data | ||
Right | 999087224 | 5:148903674-148903696 | TAGCCCATTTTTTTTCCTTCTGG | No data | ||||
999087222_999087229 | 20 | Left | 999087222 | 5:148903657-148903679 | CCCAGCAGTTTATGAGTTAGCCC | No data | ||
Right | 999087229 | 5:148903700-148903722 | CCATCTAATAACACCTCCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
999087222 | Original CRISPR | GGGCTAACTCATAAACTGCT GGG (reversed) | Intergenic | ||