ID: 999088404

View in Genome Browser
Species Human (GRCh38)
Location 5:148913315-148913337
Sequence AGGATGAAGCAGCATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999088404_999088411 -5 Left 999088404 5:148913315-148913337 CCTGCCTCATGCTGCTTCATCCT No data
Right 999088411 5:148913333-148913355 ATCCTGGGATCATGGGGCTCAGG No data
999088404_999088413 28 Left 999088404 5:148913315-148913337 CCTGCCTCATGCTGCTTCATCCT No data
Right 999088413 5:148913366-148913388 ATGCATTTCAAGATTCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999088404 Original CRISPR AGGATGAAGCAGCATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr