ID: 999088412

View in Genome Browser
Species Human (GRCh38)
Location 5:148913335-148913357
Sequence AGCCTGAGCCCCATGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999088412_999088413 8 Left 999088412 5:148913335-148913357 CCTGGGATCATGGGGCTCAGGCT No data
Right 999088413 5:148913366-148913388 ATGCATTTCAAGATTCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999088412 Original CRISPR AGCCTGAGCCCCATGATCCC AGG (reversed) Intergenic
No off target data available for this crispr