ID: 999088413

View in Genome Browser
Species Human (GRCh38)
Location 5:148913366-148913388
Sequence ATGCATTTCAAGATTCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999088412_999088413 8 Left 999088412 5:148913335-148913357 CCTGGGATCATGGGGCTCAGGCT No data
Right 999088413 5:148913366-148913388 ATGCATTTCAAGATTCCCGAAGG No data
999088407_999088413 24 Left 999088407 5:148913319-148913341 CCTCATGCTGCTTCATCCTGGGA No data
Right 999088413 5:148913366-148913388 ATGCATTTCAAGATTCCCGAAGG No data
999088404_999088413 28 Left 999088404 5:148913315-148913337 CCTGCCTCATGCTGCTTCATCCT No data
Right 999088413 5:148913366-148913388 ATGCATTTCAAGATTCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999088413 Original CRISPR ATGCATTTCAAGATTCCCGA AGG Intergenic
No off target data available for this crispr