ID: 999089232

View in Genome Browser
Species Human (GRCh38)
Location 5:148920926-148920948
Sequence CTCTTCCCACTAGCAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999089226_999089232 -10 Left 999089226 5:148920913-148920935 CCCCCAGCCAAGGCTCTTCCCAC No data
Right 999089232 5:148920926-148920948 CTCTTCCCACTAGCAGAACTGGG No data
999089223_999089232 2 Left 999089223 5:148920901-148920923 CCTCCTCATTAGCCCCCAGCCAA No data
Right 999089232 5:148920926-148920948 CTCTTCCCACTAGCAGAACTGGG No data
999089225_999089232 -1 Left 999089225 5:148920904-148920926 CCTCATTAGCCCCCAGCCAAGGC No data
Right 999089232 5:148920926-148920948 CTCTTCCCACTAGCAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999089232 Original CRISPR CTCTTCCCACTAGCAGAACT GGG Intergenic
No off target data available for this crispr