ID: 999092634

View in Genome Browser
Species Human (GRCh38)
Location 5:148950760-148950782
Sequence CAGAGTAGAGGGAAGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1756
Summary {0: 1, 1: 0, 2: 12, 3: 163, 4: 1580}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999092634_999092643 27 Left 999092634 5:148950760-148950782 CCCCCTTCCTTCCCTCTACTCTG 0: 1
1: 0
2: 12
3: 163
4: 1580
Right 999092643 5:148950810-148950832 TTTATTTCTATTTATGTATCAGG 0: 1
1: 1
2: 8
3: 108
4: 1106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999092634 Original CRISPR CAGAGTAGAGGGAAGGAAGG GGG (reversed) Intronic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
900827379 1:4937659-4937681 AACAGCAGAGGGAAGGAAGGAGG + Intergenic
900868552 1:5285825-5285847 CAGGATAGAGGGATGGGAGGGGG + Intergenic
900892304 1:5458355-5458377 GAGGAAAGAGGGAAGGAAGGAGG - Intergenic
900920989 1:5670292-5670314 CAGAATAGTGGGGAGGGAGGCGG + Intergenic
900926750 1:5710761-5710783 GAGGGAAGAGGGAAGGAAGGAGG + Intergenic
901178560 1:7323019-7323041 AAAAGTAGAAGGAAAGAAGGAGG - Intronic
901203583 1:7481082-7481104 CAGAAGAGAGGGAGAGAAGGAGG - Intronic
901215479 1:7552532-7552554 CCGACAGGAGGGAAGGAAGGAGG + Intronic
901239841 1:7686487-7686509 CAGAATAGAGGAAGGGGAGGTGG + Intronic
901479180 1:9512600-9512622 CAGAGGAGAACAAAGGAAGGGGG - Intergenic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902267951 1:15281781-15281803 AAAAGGAGAGGGGAGGAAGGGGG + Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902628327 1:17689539-17689561 AAGAAGAGAGGGAGGGAAGGAGG - Intronic
902843198 1:19088633-19088655 CAGAGTAGGAGGAAGGAACTAGG - Intronic
903221632 1:21872761-21872783 CTGGGTAGACGGATGGAAGGAGG + Intronic
903225810 1:21893667-21893689 CAGAGTAGAGACAGAGAAGGAGG + Intronic
903314302 1:22489235-22489257 CAGAAGAGAGGGAAGGTAAGAGG + Intronic
903331725 1:22600100-22600122 GAGAGAAGGAGGAAGGAAGGAGG + Intronic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904416595 1:30365584-30365606 GAGAGTGGAGGGAAGGGAAGAGG + Intergenic
904478693 1:30780848-30780870 CAGAGAGGAGGGAAGAAATGGGG + Intergenic
904480641 1:30791300-30791322 AGGAAAAGAGGGAAGGAAGGAGG + Intergenic
904480755 1:30791788-30791810 AGGAAGAGAGGGAAGGAAGGAGG + Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904893683 1:33798448-33798470 AAGAGGAGAGAGATGGAAGGGGG + Intronic
904944430 1:34188964-34188986 AAGAAAACAGGGAAGGAAGGTGG - Intronic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905160988 1:36033696-36033718 CAGAGGAGAGGAAAGGAACAGGG + Intronic
905172935 1:36119688-36119710 CAGCACAGTGGGAAGGAAGGAGG + Intronic
905488981 1:38328844-38328866 CAGAGAAGAGGGAAGGATGTGGG - Intergenic
905495750 1:38384515-38384537 CAGAGGAGAAAGATGGAAGGTGG - Intergenic
905506201 1:38481492-38481514 CAGAGTGGGATGAAGGAAGGTGG - Intergenic
905536389 1:38725570-38725592 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905734852 1:40317666-40317688 CAGAGGAGAGGGGAGCAAGGTGG - Intronic
905794536 1:40808187-40808209 GAAAGACGAGGGAAGGAAGGAGG + Intronic
905864669 1:41370284-41370306 CAGAGAAGAGGGAGAGAAGAGGG + Intronic
906197714 1:43939253-43939275 AGGAGGGGAGGGAAGGAAGGAGG + Intergenic
906281500 1:44557401-44557423 GAGAGAGGAAGGAAGGAAGGAGG + Intronic
906764766 1:48418734-48418756 AAGAGAGGAAGGAAGGAAGGAGG + Intronic
906883708 1:49621396-49621418 CAGAGGAGAACAAAGGAAGGAGG + Intronic
906905565 1:49887078-49887100 AGGAGTATAGGCAAGGAAGGTGG + Intronic
907226240 1:52949643-52949665 CAGAGGAGAACAAAGGAAGGAGG + Intronic
907437427 1:54458757-54458779 CAGGAGGGAGGGAAGGAAGGAGG + Intergenic
907519814 1:55015798-55015820 CTGAGCAGAGGGAAGCACGGCGG + Intergenic
907569390 1:55468812-55468834 GAGAGAAGAAGGAAGGAAAGGGG + Intergenic
907578769 1:55553095-55553117 CAGAGAAGAGGGAAAGGAAGGGG - Intergenic
907621317 1:55983532-55983554 CAGAGGGGAGGGGAGTAAGGGGG + Intergenic
907820667 1:57964806-57964828 AAGAGAAGAAGGAAGGAAAGAGG + Intronic
908046980 1:60181336-60181358 CAGAGTAAAAGTAAGGAAGCTGG - Intergenic
908138454 1:61157305-61157327 GGGAGTGGAGGGAAGGAAAGAGG - Intronic
908139465 1:61169287-61169309 CAGAATAGTGGGAAGGAAAAAGG - Intronic
908714594 1:67055650-67055672 CAGCAGAGAGGGAAGGAAGTAGG - Intergenic
909005063 1:70265934-70265956 GAGGGAAGAAGGAAGGAAGGAGG + Intronic
909292832 1:73905860-73905882 GAGAGAAGAGGGAGGGAAAGGGG - Intergenic
909443420 1:75723046-75723068 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
909463765 1:75949184-75949206 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
909857004 1:80547664-80547686 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
909959566 1:81823355-81823377 GAGGGGGGAGGGAAGGAAGGAGG - Intronic
910248796 1:85171908-85171930 CAGAGAAGAGGGGAGGGCGGGGG + Intronic
910684660 1:89904028-89904050 CTGAGTAGGGGGAAGTTAGGTGG - Intronic
911168519 1:94746207-94746229 CAGAGTCTAGGGAAGTAAGCAGG - Intergenic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
912069586 1:105792911-105792933 AAGAGAAGAGGGAAGAAATGGGG - Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912231641 1:107799849-107799871 CAGAGTCCAGGAAGGGAAGGAGG - Intronic
912438973 1:109683942-109683964 CAGAGGAGAACAAAGGAAGGGGG - Intronic
912441495 1:109702387-109702409 CAGAGGAGAACAAAGGAAGGGGG - Intronic
912451555 1:109770583-109770605 CAGAAGAGAGGGAAAGAAGGAGG - Intronic
912641095 1:111346695-111346717 TAGAGTAGAGGGCAGGTAGGGGG + Intronic
912665232 1:111572890-111572912 AAGAGTAGAGGGTGGGAAGAGGG - Intronic
912699963 1:111870340-111870362 CAGTGCAGAAGGAAGGGAGGTGG + Intronic
912772071 1:112473187-112473209 CAGGAGAGAGGGAGGGAAGGAGG + Intronic
912813453 1:112810974-112810996 CAGGCGAGAGGGAAAGAAGGAGG - Intergenic
913047988 1:115089678-115089700 CCCACTGGAGGGAAGGAAGGTGG - Intergenic
913251741 1:116917474-116917496 CAGAGAGGAGGGAAGGGAGAGGG + Intronic
913256229 1:116956549-116956571 CAGAGCAGCAGGAAGGAAGGCGG + Intronic
913397474 1:118388178-118388200 CAGAGTAGCGTAAAGGAAGAGGG - Intergenic
913482087 1:119298518-119298540 CAGAGTATAGGCAAGGATGAGGG - Intergenic
913583961 1:120254796-120254818 GGGAGGGGAGGGAAGGAAGGAGG + Intergenic
913624220 1:120643544-120643566 GGGAGGGGAGGGAAGGAAGGAGG - Intergenic
914196439 1:145450425-145450447 CTGAGCAGAGGGCAGGATGGTGG + Intergenic
914565948 1:148866640-148866662 GGGAGGGGAGGGAAGGAAGGAGG + Intronic
914684504 1:149966332-149966354 CTGAGTGGAGGGAAGGAATCAGG - Intronic
914872538 1:151487244-151487266 AAGAAAAGAGGGAGGGAAGGAGG - Intergenic
914944742 1:152053820-152053842 CAGGGTAGGGGGAAGGCTGGCGG - Intergenic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
914960114 1:152197528-152197550 GAAAGGAGAGAGAAGGAAGGAGG - Intergenic
915367223 1:155323201-155323223 CAGAATGGAGGGAAGACAGGGGG - Intronic
915521308 1:156446021-156446043 CAGGGAAGAGGAAACGAAGGAGG + Intergenic
915587097 1:156849714-156849736 GAGAGTCGAGGGAAGGATGGGGG - Intronic
915840914 1:159212258-159212280 CAGAGTAGAGGGAATGGGTGTGG + Intergenic
916242498 1:162654024-162654046 CAGATCAGAGGAAAGGAAAGAGG + Intronic
916565734 1:165975118-165975140 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
916616690 1:166448969-166448991 GAGAGGAGAGCGAAGGATGGAGG - Intergenic
916742383 1:167657602-167657624 CAGAGGGGAGGGGAGGAAGGAGG - Intronic
917077377 1:171219518-171219540 CAGAGGAGAACAAAGGAAGGGGG - Intergenic
917077866 1:171224516-171224538 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
917443981 1:175091258-175091280 GAGAGAAAAGGGAAGGCAGGGGG + Intronic
917499650 1:175574681-175574703 CATAGGAGAGGAAAGAAAGGAGG - Intronic
917599960 1:176563966-176563988 AAAAAAAGAGGGAAGGAAGGTGG - Intronic
917923808 1:179772214-179772236 GTGAGCAGAGGAAAGGAAGGTGG - Intronic
918195016 1:182213191-182213213 GAGGGAAGAAGGAAGGAAGGTGG - Intergenic
918224936 1:182472649-182472671 CATAGAAGATGGAAAGAAGGTGG - Intronic
918459099 1:184757089-184757111 CAGACTAGAAGGAAGAAAGAAGG - Intergenic
919243028 1:194939137-194939159 GAGACTAGGGGGCAGGAAGGGGG + Intergenic
919392966 1:197010548-197010570 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
919443770 1:197674587-197674609 CAGAGAAAAGGGAATGAAGTTGG + Intronic
919620667 1:199861265-199861287 AGGAGTAGAGGGAAGGAAACAGG - Intergenic
919637295 1:200015197-200015219 AGGAGGAGAGGGAGGGAAGGAGG + Intergenic
919669120 1:200322611-200322633 CAAAGAAAAGGAAAGGAAGGTGG - Intergenic
919724160 1:200871352-200871374 CAGAGCCCAGGGTAGGAAGGTGG - Intergenic
919763188 1:201111120-201111142 CAGAAGAGAGGCAAGGAGGGAGG + Intronic
919846002 1:201642607-201642629 AAAAGGAAAGGGAAGGAAGGTGG - Intronic
919973056 1:202593098-202593120 CAGAGGAAAGGGAAGGGAAGGGG + Exonic
920264552 1:204712110-204712132 CTGAGTAGAGGGATGGAGGCCGG - Intergenic
920351280 1:205339592-205339614 CTGAGCCAAGGGAAGGAAGGAGG + Intronic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
920811067 1:209286083-209286105 AAGGATAGAAGGAAGGAAGGAGG + Intergenic
921056331 1:211545295-211545317 AAGAGCAGAGTGAAGGAAGAGGG - Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921342107 1:214144603-214144625 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921434778 1:215105733-215105755 CAGGGAAGAAGGAAGGGAGGAGG - Intronic
921667428 1:217889580-217889602 CAGAGGACAGGGACGGTAGGGGG + Intergenic
921692430 1:218165502-218165524 TAGAAGAGAGGGGAGGAAGGGGG + Intergenic
921946039 1:220886865-220886887 CGGAGTCTAGGGAAGAAAGGTGG + Intergenic
922027805 1:221768181-221768203 AAGTGAAGAGGGAAGAAAGGGGG - Intergenic
922238680 1:223740516-223740538 CAGAGGAGAACAAAGGAAGGAGG + Intronic
922358500 1:224798975-224798997 CAGAAAATAGGAAAGGAAGGGGG + Intergenic
922875932 1:228939965-228939987 CAGAGGACAGGGAAGGAAAGAGG + Intergenic
923025802 1:230203104-230203126 CAGAGCAGAGGGTAGGGATGAGG - Intronic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923127579 1:231045981-231046003 GAGAGAAGAGGGAGGGAGGGAGG + Intergenic
923309212 1:232719315-232719337 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
923322190 1:232845585-232845607 CAGAGTCAAGGGAAGAAAGATGG - Intergenic
924010179 1:239656149-239656171 AATGGGAGAGGGAAGGAAGGGGG + Intronic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
924173206 1:241362671-241362693 CAGAGTACAGGGAAGGTACATGG - Intergenic
924187252 1:241506326-241506348 CAAAGTATAGGGAAGGATGAGGG + Intronic
924197503 1:241623750-241623772 CAGAGCAAAGGGAATGAAAGAGG - Intronic
924290350 1:242529841-242529863 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
924539877 1:244970688-244970710 GAGAGAAGAGGGAGGGAAGAGGG - Exonic
924562210 1:245166260-245166282 AAGGAAAGAGGGAAGGAAGGAGG - Intronic
924712213 1:246538872-246538894 AAGGAGAGAGGGAAGGAAGGAGG + Intergenic
1063026976 10:2189488-2189510 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1063156315 10:3382275-3382297 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1063198001 10:3760846-3760868 AAGTAGAGAGGGAAGGAAGGAGG - Intergenic
1063349128 10:5338201-5338223 AAGGGAGGAGGGAAGGAAGGAGG - Intergenic
1063377033 10:5560721-5560743 CAGATTTGAGGAAAGGAAGATGG - Intergenic
1063488335 10:6440650-6440672 CTGAGCAGAGGAAAGGAAGCAGG + Intronic
1063521612 10:6746640-6746662 CAGTGTAGTGGGGAGAAAGGGGG - Intergenic
1063528968 10:6811759-6811781 CAGAGTACATCGAAGGAATGAGG - Intergenic
1063597986 10:7454596-7454618 AAGAGTGGAGGGCAGGATGGGGG + Intergenic
1063698042 10:8356615-8356637 GAGAGGAGAGGAAAGGAGGGAGG - Intergenic
1063711415 10:8482717-8482739 GAGAGAGGAGGGAGGGAAGGAGG - Intergenic
1063799787 10:9561706-9561728 AAGAGAATAGGGAAGGAAAGTGG - Intergenic
1063861304 10:10310747-10310769 CAGAGGAGAGGGAAGGACTGAGG + Intergenic
1063919702 10:10920696-10920718 GAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1064050672 10:12056832-12056854 CAGAGAAGAGAGAAAGGAGGGGG - Intergenic
1064110366 10:12533611-12533633 AAGAGTAGAGGGAGGCAGGGTGG - Intronic
1064121374 10:12622826-12622848 CTGAGTAGAGGGGAGGATGTAGG + Intronic
1064146045 10:12827162-12827184 GAGAGAAGAGAGAGGGAAGGAGG - Intronic
1064291860 10:14042295-14042317 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1064405548 10:15059124-15059146 AAGGGGAGAGGGAGGGAAGGGGG - Intronic
1064709452 10:18108988-18109010 CAGAGTCAAGGAAAGGAAGAGGG - Intergenic
1064877722 10:20014233-20014255 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1065063047 10:21927954-21927976 CAGAGTAAAGGAAGGGAAGGAGG + Intronic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065383956 10:25115437-25115459 AAGGATGGAGGGAAGGAAGGAGG - Intergenic
1065438360 10:25724496-25724518 GAGAAAGGAGGGAAGGAAGGAGG + Intergenic
1065478363 10:26165504-26165526 CATAATCGAGGGAAGGAAAGAGG - Intronic
1065497209 10:26341788-26341810 GAGAATGGAAGGAAGGAAGGAGG + Intergenic
1065497248 10:26341949-26341971 GAGAATGGAAGGAAGGAAGGGGG + Intergenic
1065866424 10:29919076-29919098 CAGAAGAGAGGGGAGGAGGGAGG - Intergenic
1065874183 10:29982969-29982991 AAGGGGAGAGGGAGGGAAGGAGG + Intergenic
1066111427 10:32200531-32200553 CAGAGAAGAGGGGAGGATGAGGG + Intergenic
1066200264 10:33137496-33137518 CTGGCTTGAGGGAAGGAAGGGGG - Intergenic
1066218894 10:33316123-33316145 CTGAGCAGAGGGCAAGAAGGAGG + Intronic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1066555652 10:36609901-36609923 CAGGATAGAGGGAAGTAAGCTGG - Intergenic
1066756323 10:38716395-38716417 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1066996444 10:42568737-42568759 CAGAGTAGGAGCAAGGTAGGAGG - Intergenic
1067111228 10:43401948-43401970 CAGAACAGAGAGATGGAAGGAGG + Intronic
1068565361 10:58568757-58568779 CTGAGTTGAGGGAAGGCAAGGGG - Intronic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068775362 10:60862877-60862899 GAGAGAGGAGGGAAGGAAGGAGG - Intergenic
1068807830 10:61219492-61219514 CTAAGGAGAGGGAGGGAAGGAGG - Intergenic
1069213636 10:65792476-65792498 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1069299403 10:66887843-66887865 CAGATTTGAGGACAGGAAGGAGG + Intronic
1069449559 10:68505363-68505385 AAGAAAAGAGGGAGGGAAGGAGG + Intronic
1069560736 10:69427582-69427604 TAGAGTGGAGAGAGGGAAGGAGG - Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069884733 10:71616423-71616445 CAGACAGGAGGGAAGGATGGTGG - Intronic
1069886409 10:71626680-71626702 GAGAGGTGAGGGAAAGAAGGGGG + Intronic
1069911140 10:71760666-71760688 CAGAGCAGATGGAAGGAGAGTGG + Intronic
1070402421 10:76065349-76065371 CACAATAGAAAGAAGGAAGGTGG + Intronic
1070409394 10:76125603-76125625 CAGAGTACAGTGAAGGTAGGGGG + Intronic
1070479333 10:76866739-76866761 CAGAGTAGTAGGAAGCAAAGGGG - Intergenic
1070518051 10:77226023-77226045 CAGAATCTAGGGGAGGAAGGGGG + Intronic
1070711857 10:78688964-78688986 GAGAGGAGAGGGAAAGGAGGAGG - Intergenic
1070721320 10:78759255-78759277 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071200522 10:83216970-83216992 AAGAGTAGAGGGAAGAAAAGAGG + Intergenic
1071464962 10:85931222-85931244 AGGGGGAGAGGGAAGGAAGGAGG - Intronic
1071494744 10:86160491-86160513 CAGAGTGGAGGGGAAGAAGGAGG + Intronic
1071570869 10:86696173-86696195 CGCAGCAGAGGGAGGGAAGGGGG - Intronic
1071734581 10:88283808-88283830 GAGAGTAGAGGGTGGGAGGGAGG + Intronic
1071764238 10:88644180-88644202 AGGAATAGAGGGAATGAAGGAGG + Intergenic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1071809110 10:89159091-89159113 AAGAAGGGAGGGAAGGAAGGAGG + Intergenic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072412736 10:95218771-95218793 CAGATTAGATGAAGGGAAGGAGG + Intronic
1072421667 10:95294938-95294960 ATGAGAAGAGGGAAGCAAGGAGG + Intergenic
1072466605 10:95669123-95669145 CAGAGTAGTGGGGGGGTAGGAGG + Intronic
1072767142 10:98104345-98104367 GAGAGAGGAGGAAAGGAAGGAGG - Intergenic
1072783728 10:98266996-98267018 GACAGAAGAGGGAAGGAAGGTGG + Intronic
1073072550 10:100803739-100803761 CAGAGGAGAGGGAAGTGGGGAGG - Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073559710 10:104486467-104486489 CAGGGTAGATGGAAGGACAGGGG + Intergenic
1073625343 10:105091074-105091096 CAGGAGGGAGGGAAGGAAGGAGG - Intronic
1073848412 10:107586435-107586457 CAGAGGAGAGCAAAGGAAGGAGG - Intergenic
1073891011 10:108101086-108101108 CAGAGGAGAGGGAAGAAACTTGG + Intergenic
1074018911 10:109563889-109563911 CAGATGGGAGGGAAAGAAGGAGG - Intergenic
1074020851 10:109581093-109581115 CAGAGGAGAGGAAATGAAGTAGG + Intergenic
1074260897 10:111852171-111852193 CAAAGTTGAGGGGAGAAAGGAGG + Intergenic
1074401201 10:113142337-113142359 AAGGGGAGAGGGAGGGAAGGTGG + Intronic
1074596762 10:114875141-114875163 CAGTTCCGAGGGAAGGAAGGCGG + Intronic
1074599267 10:114897200-114897222 CAGAGAAGAACAAAGGAAGGAGG - Intronic
1074615892 10:115067866-115067888 CAGAAAAGAAGGAAGGAAGAAGG + Intergenic
1075120256 10:119659464-119659486 CACCGCAGATGGAAGGAAGGAGG + Intronic
1075166663 10:120074079-120074101 GAGAATATAGGGAAGGAAGGTGG - Intergenic
1075171636 10:120121016-120121038 AAGGGAAGAGGGAAGGAAGGTGG + Intergenic
1075348025 10:121698498-121698520 AAGAGCAGAGTGAAGGAAGGGGG + Intergenic
1076069146 10:127472208-127472230 GAGGATAGAGGGAGGGAAGGTGG + Intergenic
1076366316 10:129922859-129922881 CAGACCAGAGGCATGGAAGGAGG + Intronic
1076368900 10:129939248-129939270 GAGGGTGGAGGGCAGGAAGGAGG - Intronic
1076430264 10:130396954-130396976 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1076490826 10:130860183-130860205 CAGACTGGAGGAAGGGAAGGTGG - Intergenic
1076516165 10:131045518-131045540 CAGAGTAGGGGAGAGGGAGGAGG + Intergenic
1076523310 10:131094641-131094663 CAGGGGAGAGGGCAGGAAGGAGG - Intronic
1076749786 10:132537064-132537086 CAGAGAAGACGGAGGGGAGGCGG - Intergenic
1076835071 10:133016889-133016911 CAGCCCAGCGGGAAGGAAGGAGG - Intergenic
1077323953 11:1955510-1955532 CAGAGGAGAGGGAAGAGAAGAGG - Intronic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1077463542 11:2722790-2722812 TGGGGTAGAGGGAAGGAGGGAGG - Intronic
1077657063 11:4029549-4029571 GAGAGAGGAGGGACGGAAGGAGG + Intronic
1077883203 11:6367055-6367077 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1077897007 11:6460584-6460606 CATAGGAGAGTGAAGGATGGAGG + Intronic
1078073792 11:8138831-8138853 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1078221878 11:9358105-9358127 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1078444744 11:11395693-11395715 AAGAAAAGAGAGAAGGAAGGAGG + Intronic
1078579464 11:12527259-12527281 AGGAATAGAGGGAGGGAAGGAGG + Intronic
1078718129 11:13858976-13858998 CAGAGCAGAAGCAAGGAAGGGGG + Intergenic
1078923608 11:15854330-15854352 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1079088665 11:17465207-17465229 CAGAGTGGAGTGGAGGCAGGGGG - Intronic
1079189363 11:18265043-18265065 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079778991 11:24574362-24574384 AAGAAAAGAAGGAAGGAAGGAGG - Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1079934460 11:26600291-26600313 GAGAGGAGAGGGGAGGAAAGGGG - Intronic
1080391377 11:31850230-31850252 CTGAGAAGAGGCAAGGAATGTGG + Intronic
1080550989 11:33374111-33374133 CGGAGCAGAGGCAGGGAAGGAGG - Intergenic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1080926005 11:36756482-36756504 GGAAGTAGAGGGAAGGAAGTAGG + Intergenic
1080926038 11:36756787-36756809 GGAAGTAGAGGGAAGGAAGTAGG + Intergenic
1080932874 11:36831106-36831128 GACAGGAGAGGGAAGGAGGGAGG - Intergenic
1080962904 11:37181002-37181024 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1081188076 11:40069857-40069879 GAGAGGGGAGGGCAGGAAGGGGG + Intergenic
1081381755 11:42425003-42425025 AAGAGGAGAGGGAAAAAAGGAGG + Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081675124 11:44964154-44964176 CAGAGTGGAGGGGAGGGAGGAGG - Intergenic
1081806011 11:45890929-45890951 CTGAGCAGAGGGCAGGAAGATGG + Intronic
1081935977 11:46904156-46904178 AAGAGGAGAAGAAAGGAAGGGGG - Intronic
1082132366 11:48506224-48506246 GAGGGAAGGGGGAAGGAAGGGGG - Intergenic
1082565829 11:54676844-54676866 GAGGGAAGGGGGAAGGAAGGGGG - Intergenic
1082789053 11:57335021-57335043 ACAAGTAGAGAGAAGGAAGGAGG - Intronic
1083068927 11:59956158-59956180 GAGAGGAGAGGAAGGGAAGGAGG - Intergenic
1083097634 11:60267776-60267798 CAGAGTTAAGGGAACGAAGAAGG + Intergenic
1083445794 11:62707364-62707386 CAGAGTAGAGGGAGGAAAGGAGG + Exonic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1083539136 11:63499866-63499888 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1083549037 11:63572031-63572053 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1083592202 11:63902465-63902487 CAGAGGCGAGGGAAGGGAAGTGG - Intronic
1083609546 11:63998517-63998539 CTGACTGGGGGGAAGGAAGGCGG - Intronic
1083743333 11:64722500-64722522 AAGTGGAGAGGGAAGGAAAGGGG - Intronic
1084075330 11:66770764-66770786 AAGAGAAGAGGGAAGTAAAGGGG - Intronic
1084165215 11:67372363-67372385 CGGAGTTGTGGAAAGGAAGGCGG + Intronic
1084213995 11:67637558-67637580 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1084742639 11:71149648-71149670 GGGATTAGAGGAAAGGAAGGAGG + Intronic
1084904648 11:72336161-72336183 CAGAGTAGTGTCAAGGGAGGAGG - Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085326604 11:75611132-75611154 AAGGATAGAGGGAAGGAGGGAGG - Intronic
1085442290 11:76576088-76576110 CAGATCAGAGGGCAGTAAGGAGG - Intergenic
1085583826 11:77681430-77681452 CAGGGAAGAGGGAAGGAAAGGGG - Intronic
1085666057 11:78417048-78417070 CGGAATAAAGGGAAAGAAGGGGG + Intronic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086165452 11:83772510-83772532 AAGGGAAGAAGGAAGGAAGGAGG + Intronic
1086846024 11:91750700-91750722 AAGGGGAAAGGGAAGGAAGGGGG - Intergenic
1087160500 11:94943539-94943561 AAGGAGAGAGGGAAGGAAGGAGG - Intergenic
1087171974 11:95058410-95058432 GAGAGTTGAGGGAGGGAGGGAGG - Intergenic
1087425208 11:97976536-97976558 CAGAGGAGATCAAAGGAAGGAGG + Intergenic
1087630079 11:100639546-100639568 AAGAGTACAGGGGAGGAAGGAGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088102845 11:106174084-106174106 CAGAGGAGAACCAAGGAAGGAGG + Intergenic
1088438394 11:109841148-109841170 AAGAGAAGAAGGAAGGAAGGAGG + Intergenic
1088700811 11:112409596-112409618 AAGAGTAGCTGGAAGGAAGATGG - Intergenic
1088735004 11:112721309-112721331 AAGAGGAGAGGGCAAGAAGGAGG + Intergenic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089460856 11:118652691-118652713 CAGAGAAGAGGGGAGGGAGAGGG + Intronic
1089465095 11:118679808-118679830 CAAAGTAGAAGCAAGGGAGGTGG - Intergenic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1089588516 11:119525000-119525022 CAGTGTGGAGGGAAGGCAGCTGG - Intergenic
1090694476 11:129224549-129224571 CAGATCAGAGGGAAGGAATAGGG - Intronic
1090694637 11:129226521-129226543 CATAATGGAGGGAAGAAAGGGGG - Intronic
1090818852 11:130322513-130322535 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1202806939 11_KI270721v1_random:10705-10727 CAGAGGAGAGGGAAGAGAAGAGG - Intergenic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1091375509 12:22488-22510 CAGGGGAGAAGGAAGGATGGAGG + Intergenic
1091388896 12:113098-113120 CAGCATGGAGGGAAGGAAGTGGG - Intronic
1091447482 12:552348-552370 CAGACTAGAGTGGAGGAAGGAGG - Intronic
1091453554 12:588230-588252 CAGAAGGGAGGGAAGGGAGGAGG + Intronic
1091618874 12:2070919-2070941 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618904 12:2071026-2071048 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618926 12:2071098-2071120 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091818310 12:3455766-3455788 GAAAGTGGAGGGAAGGCAGGTGG + Intronic
1091860504 12:3777231-3777253 AAGGACAGAGGGAAGGAAGGAGG + Intergenic
1091901960 12:4151522-4151544 AAGAAAAGAGGGAAGGAGGGAGG - Intergenic
1091914912 12:4264469-4264491 CAGAGTAGAAGCAAGAAAGAGGG + Intergenic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092217586 12:6693997-6694019 GAGAGTGGAAGGAAGGAGGGAGG + Exonic
1092228574 12:6764601-6764623 GAGGGAAGAGGAAAGGAAGGCGG + Intronic
1092281513 12:7101255-7101277 AAGAGAGGAAGGAAGGAAGGAGG - Intronic
1092999317 12:13980632-13980654 GAGGGAAGTGGGAAGGAAGGAGG + Intergenic
1093076671 12:14766094-14766116 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1093339716 12:17957988-17958010 CAGAGTAGAGGGGAGAAAATGGG + Intergenic
1093396421 12:18688964-18688986 AGGAAAAGAGGGAAGGAAGGAGG + Intronic
1093619056 12:21265328-21265350 CACAGTGAAGGGATGGAAGGTGG + Exonic
1093838612 12:23868084-23868106 AAGAAGGGAGGGAAGGAAGGAGG - Intronic
1094018513 12:25889239-25889261 CAGAGGAGAGGGAGGGGATGGGG + Intergenic
1094549275 12:31435274-31435296 CTAAGTAGAGGGCAGGAAGAAGG - Intronic
1094628133 12:32145508-32145530 CTTGGAAGAGGGAAGGAAGGAGG + Intronic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095174471 12:39074934-39074956 CAGTCATGAGGGAAGGAAGGGGG + Intergenic
1095271771 12:40226883-40226905 CAGAGTCTAGGGAATGAAGGTGG - Intronic
1095519545 12:43046291-43046313 GAGAGTAGAGGGCAGGAGGAGGG + Intergenic
1095618661 12:44223191-44223213 CAGGGTGGAGGGTAGGAAGAGGG - Intronic
1095654113 12:44649221-44649243 CAGACAAGAAGGAGGGAAGGAGG - Intronic
1095999196 12:48114649-48114671 CAGGCCAGAGGGAAAGAAGGAGG + Intronic
1096042985 12:48536237-48536259 GAGAGCAGAGGGAGGGAGGGAGG + Intergenic
1096077737 12:48815533-48815555 CAGGGGAGAGGGAAGGGAGCAGG + Intronic
1096098985 12:48957432-48957454 CTAGGTGGAGGGAAGGAAGGAGG - Exonic
1096213066 12:49781198-49781220 CTGAAAAGAAGGAAGGAAGGAGG - Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096594303 12:52684803-52684825 CAGAGCAGAGGCCAGGAAGGAGG + Intergenic
1096840659 12:54377857-54377879 GAGAGGAGTGGGATGGAAGGGGG + Intronic
1097013714 12:55970834-55970856 CATGGTTGGGGGAAGGAAGGAGG + Intronic
1097126500 12:56780525-56780547 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097613592 12:61857702-61857724 AAGAAGAGAAGGAAGGAAGGAGG - Intronic
1097791944 12:63824524-63824546 CAAAAAAGAAGGAAGGAAGGGGG + Intergenic
1097799017 12:63892185-63892207 AAGACTAGAGGTAGGGAAGGAGG - Intronic
1097817041 12:64086235-64086257 CGGAGTAGTGGGAAGGAATGTGG - Intronic
1098261549 12:68676686-68676708 AAGGAAAGAGGGAAGGAAGGAGG + Intergenic
1098391099 12:69970917-69970939 CAGAGCAGGAGGAAGGGAGGGGG - Intergenic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098630141 12:72713046-72713068 CAGGCGAGAGGGAAAGAAGGAGG + Intergenic
1098905523 12:76157911-76157933 CATAATAGAGGGAATGGAGGGGG - Intergenic
1099670201 12:85681503-85681525 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1099893673 12:88619044-88619066 CAGAGGAGAAGGAAGGGAGGAGG + Intergenic
1099902964 12:88735290-88735312 GAGAGAAGAGGGAGAGAAGGAGG - Intergenic
1100286271 12:93169583-93169605 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100456692 12:94758584-94758606 CAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1100465201 12:94838160-94838182 CAAATTAGAGGGAAAAAAGGGGG + Intergenic
1100598714 12:96093725-96093747 CAGGATAGAAGGCAGGAAGGAGG + Intergenic
1100702286 12:97161340-97161362 GAGACTAGAGGGAATGAGGGAGG + Intergenic
1101199033 12:102415611-102415633 GAGAGAAGAAGGAAGGAAGGAGG - Intronic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101232711 12:102757528-102757550 AAGAAAAGAGGGAACGAAGGGGG - Intergenic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1102099744 12:110269337-110269359 CAGATAAAAAGGAAGGAAGGAGG - Intergenic
1102116917 12:110409831-110409853 CAGGCGAGAGGGAAAGAAGGAGG + Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102243539 12:111340834-111340856 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1102434564 12:112910882-112910904 CAGTGGAGAGGGCAGGAGGGAGG + Intronic
1102501179 12:113353630-113353652 AAGAGTGGAGGGAGGGAGGGAGG - Intronic
1102558029 12:113741813-113741835 GAGAGGAGAGGGGGGGAAGGAGG + Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102645610 12:114401729-114401751 AAGAGAAGAAGGAAGGAAAGGGG - Intronic
1102673243 12:114637764-114637786 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1102717458 12:114986544-114986566 AAGAGGAGAGGAAAGGAAGGAGG - Intergenic
1102887697 12:116534152-116534174 CACGATCGAGGGAAGGAAGGGGG - Intergenic
1102902132 12:116647091-116647113 GAAGGAAGAGGGAAGGAAGGAGG - Intergenic
1102902144 12:116647128-116647150 GAAGGAAGAGGGAAGGAAGGGGG - Intergenic
1102992023 12:117322405-117322427 AAGGGAGGAGGGAAGGAAGGAGG - Intronic
1102992056 12:117322520-117322542 AAGGAGAGAGGGAAGGAAGGAGG - Intronic
1102992121 12:117322758-117322780 AAGGAGAGAGGGAAGGAAGGAGG - Intronic
1103245538 12:119453787-119453809 AAGAGGAGAGGGAAGGGAAGAGG + Intronic
1103246737 12:119464379-119464401 GAAAGGGGAGGGAAGGAAGGAGG - Intronic
1103360404 12:120350355-120350377 CAGGGTGGAGGGCTGGAAGGAGG - Intronic
1103463714 12:121125052-121125074 AAGATTCGAAGGAAGGAAGGAGG - Intergenic
1103918540 12:124388067-124388089 CAGAGGAGAGGGGATGGAGGTGG + Intronic
1104053238 12:125210364-125210386 CAGAGCAGAGGGAGGGGATGTGG + Intronic
1104188339 12:126454144-126454166 CAGAGGAGAACAAAGGAAGGCGG + Intergenic
1104207095 12:126649691-126649713 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1104451649 12:128873867-128873889 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1104565925 12:129883043-129883065 CAGGGAAAAGGGAAAGAAGGAGG + Intronic
1104619199 12:130298119-130298141 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
1104807496 12:131598922-131598944 CAGAGTTGAGGTGAGGAGGGCGG - Intergenic
1104876025 12:132035443-132035465 CAGAGAAGTGGGAAGTAAGGCGG + Intronic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105241206 13:18610653-18610675 CAGAGGAGAGGCAAGGCCGGTGG + Intergenic
1105422668 13:20266712-20266734 CAAGGGAGTGGGAAGGAAGGAGG + Intergenic
1105592914 13:21811121-21811143 CAGAGTGGAGAGAAAGAAAGGGG + Intergenic
1105945931 13:25189422-25189444 CAGAGAGGAGGAAAGGAAAGGGG + Intergenic
1106052411 13:26204011-26204033 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1106783665 13:33086228-33086250 CAGTGTAAAGGCAAGCAAGGAGG - Intergenic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107087557 13:36442501-36442523 CAGAATGGAAGGAAGGAAGCTGG - Intronic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107333086 13:39322692-39322714 CAGAAGGGAGAGAAGGAAGGAGG + Intergenic
1107376149 13:39806909-39806931 CAGATTAGAGAGAGAGAAGGTGG - Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1108020493 13:46123157-46123179 CATAGTAAATGTAAGGAAGGTGG + Intergenic
1108502868 13:51084322-51084344 CAGGCTAGAAGGAAGGAATGAGG + Intergenic
1108770015 13:53688219-53688241 CAGAGCTGTGGGCAGGAAGGAGG + Intergenic
1108933082 13:55854803-55854825 CAAAGAAGAGGGAGGGAGGGAGG + Intergenic
1109125951 13:58517157-58517179 CTGAGTAGAGGGAATATAGGGGG - Intergenic
1109342860 13:61084092-61084114 CAGAGTAGAAGGAAGAGTGGGGG + Intergenic
1109438393 13:62337013-62337035 GAAAATAGAGGGGAGGAAGGGGG - Intergenic
1109464156 13:62706744-62706766 CAGAGAAGAGAAAAAGAAGGTGG - Intergenic
1109740690 13:66550759-66550781 CAGATTTGTGGGAAGGAAGAGGG + Intronic
1109745161 13:66614954-66614976 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1110358319 13:74595370-74595392 CGGAGGAGAGGGGAGGAGGGGGG - Intergenic
1110382075 13:74864116-74864138 CAGAGAAGAGGAATGGAGGGAGG + Intergenic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1111066255 13:83096261-83096283 AAGAAGGGAGGGAAGGAAGGAGG + Intergenic
1111255920 13:85668753-85668775 CAGAAAAGAAGCAAGGAAGGGGG + Intergenic
1111490773 13:88971814-88971836 CAGAAGAGAGGAGAGGAAGGTGG + Intergenic
1112086026 13:96033625-96033647 CAGAGAAGAGGCCAGGAAGCAGG - Intronic
1112350183 13:98626441-98626463 GAGAGGAGAGGGAAGGAAGCTGG + Intergenic
1112429346 13:99336905-99336927 AAGAGAGGTGGGAAGGAAGGGGG - Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1112518556 13:100077274-100077296 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1112533718 13:100229595-100229617 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1112759089 13:102672731-102672753 AAGAGGAGGGGGAAGGAGGGTGG + Intronic
1112876645 13:104049429-104049451 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1112945128 13:104918892-104918914 CAGAGAAGAGGAAAGTTAGGAGG - Intergenic
1112947014 13:104941479-104941501 AAGAAAAGAGGGAAGGATGGAGG + Intergenic
1113092098 13:106627065-106627087 AGGCGAAGAGGGAAGGAAGGTGG + Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113618804 13:111699351-111699373 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1113624333 13:111784612-111784634 TACAGAACAGGGAAGGAAGGTGG - Intergenic
1113665247 13:112136679-112136701 AAGAAAGGAGGGAAGGAAGGAGG - Intergenic
1113851179 13:113419071-113419093 GAGGGAAGAAGGAAGGAAGGAGG - Intergenic
1113923287 13:113926595-113926617 CAGAGGATGGGGAAGGAATGAGG + Intergenic
1114045449 14:18871643-18871665 AAGAGAGGAGGGAAGGAGGGAGG + Intergenic
1114118763 14:19647825-19647847 AAGAGAGGAGGGAAGGAGGGAGG - Intergenic
1114782284 14:25551182-25551204 CAGAGAAGAGAGAGGGAATGGGG + Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1115150398 14:30277861-30277883 AAAAGGAGAGGGACGGAAGGAGG + Intergenic
1115404747 14:33001901-33001923 CAGAAATGAGGGTAGGAAGGAGG - Intronic
1115620117 14:35132830-35132852 CAAAGGAAAGGGAAGGAAGAAGG + Intronic
1115735337 14:36321570-36321592 CAGCTTAGAGATAAGGAAGGTGG + Intergenic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1116699715 14:48224541-48224563 AAGAGCAGAAGGAAGGAAGTGGG + Intergenic
1116739838 14:48740124-48740146 CAGAGTAGAGGAAAGCAGAGAGG + Intergenic
1117180276 14:53184231-53184253 CAGAGGAGAACAAAGGAAGGTGG + Intergenic
1117248738 14:53913954-53913976 CAGAGTGGGGAGCAGGAAGGTGG - Intergenic
1117699259 14:58396518-58396540 CAAAAGGGAGGGAAGGAAGGAGG + Intronic
1117979283 14:61326425-61326447 GAGAGTGGAGGTAAGGGAGGTGG + Intronic
1118345857 14:64940314-64940336 CAGGGCAGAGGAAAGGAAAGGGG - Intronic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1119133468 14:72195513-72195535 CAGAGTAGAGAGAAGAAAAGAGG + Intronic
1119135582 14:72215653-72215675 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1119180213 14:72600325-72600347 CAGAGAGGAGGGAGGGAGGGAGG - Intergenic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119614699 14:76091455-76091477 AAGGGGAGAGGGCAGGAAGGAGG - Intergenic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1119717422 14:76868742-76868764 CTGAGTGGAGCGAAGGAAAGAGG - Intronic
1119759002 14:77138591-77138613 CAGAGCAGAGGGAACGTGGGTGG - Intronic
1120241405 14:81953624-81953646 TAGTGTAGAGAGAAGGAAGCAGG - Intergenic
1120391256 14:83911156-83911178 GAGAGAAGAGTGAGGGAAGGAGG - Intergenic
1120654919 14:87177920-87177942 CAGAGTAGAGGGAATAACAGAGG + Intergenic
1120807577 14:88769307-88769329 TAGAGTAGAAGGAAGCGAGGTGG - Intronic
1120955478 14:90078446-90078468 AAGAGAGGAAGGAAGGAAGGAGG + Intronic
1121078310 14:91087624-91087646 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1121083138 14:91125005-91125027 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1121122167 14:91382980-91383002 CAGAGTTGGAGGATGGAAGGAGG - Intronic
1121630573 14:95418919-95418941 GGGAGAAGAGGGAAGGAAAGAGG - Intronic
1121787678 14:96674618-96674640 AAGGACAGAGGGAAGGAAGGGGG - Intergenic
1122053922 14:99079413-99079435 CAGGGTTCAGGGAAGGCAGGAGG + Intergenic
1122156545 14:99753535-99753557 GGGAGTAGAGGGAGTGAAGGAGG - Intronic
1122248495 14:100421409-100421431 CACAGAAGAGGGGAGGAAGCAGG + Intronic
1122266159 14:100547847-100547869 GGGAGTAGAGGGCAGGCAGGAGG + Intronic
1122826685 14:104374105-104374127 CAGAGTCGGGGGGAGGACGGAGG - Intergenic
1122834515 14:104424273-104424295 CAGGGCAGTGGGATGGAAGGAGG + Intergenic
1122837637 14:104437853-104437875 CAGGGAAGGAGGAAGGAAGGGGG + Intergenic
1202920792 14_KI270723v1_random:29127-29149 CAGAGAGTAGGGAAGGAAGTCGG + Intergenic
1202924124 14_KI270724v1_random:8454-8476 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
1123440587 15:20288467-20288489 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1123457518 15:20439353-20439375 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123457545 15:20439477-20439499 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123660526 15:22560944-22560966 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660553 15:22561068-22561090 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123776557 15:23586333-23586355 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1123832298 15:24152935-24152957 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1123847597 15:24318625-24318647 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1123866638 15:24526008-24526030 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1124656418 15:31512665-31512687 CAGAGGAGAATAAAGGAAGGAGG + Intronic
1125046960 15:35252637-35252659 GAGAGGAGAGGAAAAGAAGGAGG - Intronic
1125108104 15:35997621-35997643 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1125299945 15:38244718-38244740 GAGAGTTGAGGGCGGGAAGGCGG + Intergenic
1125331891 15:38590584-38590606 CAGAGAAGATGGAAGGAGAGAGG - Intergenic
1125633288 15:41166179-41166201 AACAGTAGAGGGAAGCAATGGGG + Intergenic
1125916474 15:43492724-43492746 GAGAGAAGAGGTTAGGAAGGAGG - Intronic
1125917670 15:43503687-43503709 AAGGAGAGAGGGAAGGAAGGAGG - Intronic
1126056417 15:44734032-44734054 CAAAGTAGAGAGAAGGAATTTGG + Intronic
1126118689 15:45231877-45231899 GAGGAGAGAGGGAAGGAAGGAGG + Intergenic
1126187369 15:45843379-45843401 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1126374833 15:47987044-47987066 CAGAGTAAATGCAGGGAAGGAGG + Intergenic
1126423198 15:48497748-48497770 CAGGGTAGATGGAAGAAAGAGGG - Intronic
1126530266 15:49703289-49703311 CAGGTGAGAGGGAAAGAAGGAGG + Intergenic
1126723659 15:51608596-51608618 AAGAGTGGAAGGAAGGAAGAGGG + Intronic
1126847783 15:52777356-52777378 CAGATTGGAGGGAGAGAAGGGGG - Intronic
1126919712 15:53507530-53507552 CAGAGGACAGGGAAGGCAGATGG - Intergenic
1127446377 15:59067291-59067313 GGGAAGAGAGGGAAGGAAGGAGG - Intronic
1127488885 15:59443455-59443477 CAGATTAGAGGAAATGAAAGAGG - Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127566713 15:60196546-60196568 AGGAATAAAGGGAAGGAAGGAGG + Intergenic
1127800305 15:62471958-62471980 CAGGGGAGAAGGAAGAAAGGAGG - Intronic
1127911064 15:63416691-63416713 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1128354541 15:66915623-66915645 CAGAGTACAGGGTAGGAACAGGG + Intergenic
1128596670 15:68957991-68958013 CAGAGAAGAATCAAGGAAGGAGG + Intronic
1128608582 15:69056521-69056543 AAGAGAAGAGGGAAGATAGGTGG - Intronic
1128677822 15:69624691-69624713 GAGAGGAGAGGGAGGGAAGATGG - Intergenic
1128796913 15:70472808-70472830 CAATGTAGAGGGAAGGAGGAAGG + Intergenic
1128796930 15:70472857-70472879 AAGAAAAGAAGGAAGGAAGGGGG + Intergenic
1129164513 15:73768717-73768739 GAGAGGAGAGGAAGGGAAGGAGG - Intergenic
1129675666 15:77631597-77631619 CTGAGAAGAGGGAGGTAAGGAGG - Intronic
1129687772 15:77696322-77696344 CGGGGTGGAGGGAAGGGAGGCGG - Intronic
1129868644 15:78927190-78927212 AGGACTAGAGGGAAAGAAGGTGG - Intronic
1129933058 15:79428287-79428309 GAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1130044674 15:80434729-80434751 CAGAGGAGAGGCAGGGAACGGGG + Intronic
1130051186 15:80485294-80485316 TAGAGGAGAGGGAAGAAAAGAGG + Intronic
1130125727 15:81092584-81092606 GAGACAAGAGGGAAGGAAGAAGG + Intronic
1130127418 15:81105374-81105396 AAGGGAAGAAGGAAGGAAGGAGG - Intronic
1130759956 15:86808694-86808716 AAGGGAAGAAGGAAGGAAGGAGG - Intronic
1130879117 15:88039910-88039932 CAGAGGAGAACCAAGGAAGGAGG + Intronic
1130944393 15:88540053-88540075 CAGAGTAGGGGGCAGGGACGAGG - Intronic
1131010309 15:89012009-89012031 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131111014 15:89765572-89765594 AAGAGGAAAGGGAAGGGAGGAGG + Intronic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1131459984 15:92611109-92611131 GAGGGGAGAAGGAAGGAAGGAGG + Intergenic
1131625314 15:94112300-94112322 CAGAGTAAATGTAAGGAAAGCGG - Intergenic
1131651967 15:94409921-94409943 CAGAGTAGAGGGGATAAATGGGG - Intronic
1131756317 15:95566695-95566717 GTGAGTAGAAGGAAGGAAGGTGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1131835274 15:96384093-96384115 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1131920630 15:97324176-97324198 CAGAGAAGTGGGATGGGAGGTGG + Intergenic
1132037188 15:98494189-98494211 CAGAGTGGTGAGAAGGCAGGAGG + Intronic
1132209787 15:100011385-100011407 CAGAAGGGAGGGAAGGAAGGAGG + Intronic
1132340984 15:101078588-101078610 CAGAGGAGAGGGGACAAAGGGGG - Intergenic
1132520861 16:387907-387929 CAAAGTATAGAGAAGGAAAGGGG + Intergenic
1132701293 16:1223196-1223218 CCGAGGGGAGGGAAGGAGGGAGG + Intronic
1133489598 16:6254833-6254855 CAGAGAACAGGGCAGGAAAGAGG - Intronic
1133517279 16:6521526-6521548 GAGAGGAGAGGAGAGGAAGGAGG - Intronic
1133730818 16:8577200-8577222 CAGAGTAGAGGGAAGGGAAGTGG - Intronic
1133770993 16:8867210-8867232 GAGAATGGAGGGAAGGATGGAGG - Intronic
1134310495 16:13071627-13071649 CAGGAAGGAGGGAAGGAAGGAGG - Intronic
1134543994 16:15093839-15093861 CGAAGAAGAGGGAAGGAAGAGGG + Intronic
1134689724 16:16183371-16183393 AAGAGTAGCGGGAGGGAGGGAGG - Intronic
1134811623 16:17172184-17172206 GAGAGAGGAGGGAAGGAAGGAGG - Intronic
1134880727 16:17743573-17743595 CAAAGTGGAGGTAAGGAATGAGG + Intergenic
1135005385 16:18817495-18817517 AAGAGGAGATGGGAGGAAGGTGG + Intronic
1135361568 16:21819989-21820011 CGAAGAAGAGGGAAGGAAGAGGG + Intergenic
1135597755 16:23756306-23756328 CAAGGTGGGGGGAAGGAAGGTGG + Intronic
1135785409 16:25344526-25344548 GAGAGTAGAGGGTTGAAAGGAGG + Intergenic
1136083642 16:27869021-27869043 GAGGGAGGAGGGAAGGAAGGAGG + Intronic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136260969 16:29075405-29075427 CGAAGAAGAGGGAAGGAAGAGGG - Intergenic
1136350427 16:29703425-29703447 CAGAAAGGAAGGAAGGAAGGAGG + Intergenic
1136360451 16:29776054-29776076 CCAAGAAGAGGGAAGGATGGAGG - Intergenic
1136638845 16:31544733-31544755 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1136726254 16:32359897-32359919 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1136775486 16:32869622-32869644 CAGCCTTGAGGGGAGGAAGGTGG + Intergenic
1136844597 16:33565976-33565998 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1136895130 16:33991890-33991912 CAGCCTTGAGGGGAGGAAGGTGG - Intergenic
1137379504 16:47984217-47984239 CAGAGAATAGGGAGTGAAGGAGG + Intergenic
1137442024 16:48505955-48505977 GAGAGCACAGGGAAGGTAGGAGG + Intergenic
1137513161 16:49119004-49119026 CAGAGTGGTGGGAGGGCAGGAGG - Intergenic
1137598758 16:49742324-49742346 CAGATGAGAGGGAGGGAAGAGGG + Intronic
1138087155 16:54143584-54143606 TAAAGAAGAAGGAAGGAAGGAGG + Intergenic
1138378105 16:56580928-56580950 AAGGAAAGAGGGAAGGAAGGAGG - Intergenic
1138414873 16:56865883-56865905 AAGAGTGGAGGGCTGGAAGGTGG + Intronic
1138636429 16:58342401-58342423 CAGGGCAGGGGGAATGAAGGGGG - Intronic
1138644221 16:58411573-58411595 AAGAGAGGAAGGAAGGAAGGGGG + Intergenic
1138687272 16:58736419-58736441 CAGAGGAGAGCAAAGGAAGGAGG - Intergenic
1139190919 16:64861941-64861963 AAGAGGCAAGGGAAGGAAGGAGG + Intergenic
1139588419 16:67919167-67919189 CAGAGTGGAGGCAGGGAAGCGGG + Intronic
1139595928 16:67958294-67958316 CAGAAGAGAGGAAGGGAAGGAGG - Intronic
1139640850 16:68290451-68290473 CAGAGTAGAGGGCAAGAGAGAGG - Exonic
1139672551 16:68501663-68501685 GAGAGGAGAGAGAAAGAAGGAGG - Intergenic
1139823725 16:69740719-69740741 CAGTGGAGATGGTAGGAAGGAGG - Intergenic
1139923063 16:70471558-70471580 CAGAGCAGATGCAAGGAGGGAGG - Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140541501 16:75760336-75760358 AAGAAAAGAAGGAAGGAAGGAGG - Intronic
1140681641 16:77390993-77391015 TAGAGTAGATGGAAGGATGGTGG - Intronic
1140780256 16:78289455-78289477 CAGGGTAGTGGGAAGGAACAGGG + Intronic
1140781435 16:78300492-78300514 GAGGGGAGAGGGAAGGAGGGAGG - Intronic
1140846261 16:78891314-78891336 CAGAAAGGAGGGAAGGGAGGAGG - Intronic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1140987329 16:80170701-80170723 GAGGGTAGAGGGAAGTAAGGGGG + Intergenic
1141052179 16:80779095-80779117 AAGAAAAGAAGGAAGGAAGGAGG + Intronic
1141056853 16:80824818-80824840 AAGAGAAGGAGGAAGGAAGGAGG + Intergenic
1141286346 16:82676010-82676032 CAAAGGACAGGGAAGAAAGGAGG + Intronic
1141312328 16:82926507-82926529 CAGAGCAGAGGGAAGAAAGTGGG - Intronic
1141421453 16:83920525-83920547 CAGATTCGAGGGCAGGAGGGAGG - Exonic
1141421621 16:83921397-83921419 GAGGGTGGATGGAAGGAAGGAGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141856252 16:86683203-86683225 GAGGAAAGAGGGAAGGAAGGAGG + Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142109433 16:88323414-88323436 CAGAGAAGTGGGAAGGAAGAAGG - Intergenic
1142235250 16:88919158-88919180 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1142251394 16:88993625-88993647 GAGAGGAGGGGGGAGGAAGGAGG - Intergenic
1142318193 16:89362834-89362856 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1142322368 16:89392019-89392041 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1142441293 16:90099584-90099606 CAGAGGAGAACGAAGGAAGGAGG - Intergenic
1203000178 16_KI270728v1_random:157859-157881 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1203077904 16_KI270728v1_random:1131731-1131753 CAGCCTTGAGGGGAGGAAGGTGG + Intergenic
1203131779 16_KI270728v1_random:1694262-1694284 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1203154764 16_KI270728v1_random:1866274-1866296 GAGGGGAGGGGGAAGGAAGGAGG + Intergenic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1142851038 17:2704898-2704920 CAGAGAAGAGGAGAGGAAGAGGG - Intronic
1143303645 17:5929237-5929259 GGGAGAAGAGAGAAGGAAGGAGG - Intronic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1143458037 17:7080341-7080363 CCGAGAAGAGGAAAGGAAGTAGG - Intergenic
1143573988 17:7779113-7779135 CAGACTAGGGGGCAGGGAGGAGG - Intronic
1143999945 17:11044428-11044450 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1144237287 17:13273936-13273958 CAGAATATAGGGAGGGAAGGAGG - Intergenic
1144242734 17:13329289-13329311 AAGAATAAAGGGAAGGCAGGAGG + Intergenic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1144764115 17:17723703-17723725 CAGACTCGGGGGAAGGGAGGAGG - Intronic
1145087736 17:19956902-19956924 CCTGGTTGAGGGAAGGAAGGAGG + Intronic
1145912409 17:28550247-28550269 CAGAGCATAGGGAACGGAGGTGG + Intronic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1146057194 17:29587418-29587440 CACAATAGAGGTCAGGAAGGTGG - Intronic
1146178042 17:30679428-30679450 CAGAGGAGAGGGGAGGACAGAGG + Intergenic
1146178115 17:30679608-30679630 CAGAGGAGGGGGGAGGACGGGGG + Intergenic
1146178138 17:30679670-30679692 CAGAGGAGCAGGAAGGAGGGGGG + Intergenic
1146178175 17:30679778-30679800 CAGAGGAGTGGGGAGGACGGAGG + Intergenic
1146371626 17:32268127-32268149 CAGAGTAGGGAGGAGGCAGGAGG - Intronic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1146821172 17:35984531-35984553 CATGGAGGAGGGAAGGAAGGAGG + Intronic
1146931506 17:36781269-36781291 CTGGGAAGAGGGAAGGCAGGAGG + Intergenic
1146976598 17:37118496-37118518 CAAAGTAGAGGGGAAGTAGGTGG + Intronic
1147119831 17:38329494-38329516 CAGTGTGGAGGCCAGGAAGGTGG - Exonic
1147132139 17:38415773-38415795 GAGATGAGAGGGAAGGAGGGGGG - Intergenic
1147156977 17:38548933-38548955 CAGAGAACATGGAAGGAAAGAGG - Intronic
1147911954 17:43861294-43861316 CAGAGTGGAGGCAGGCAAGGTGG - Intronic
1148026498 17:44592734-44592756 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1148206394 17:45783010-45783032 CTGAGAAGAGGGCAGGAGGGAGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148764120 17:50027568-50027590 CACAGCAGAGGGAAGGGAGAAGG - Intergenic
1149088056 17:52743389-52743411 GAGAGTAGAGGAAAGTAAAGAGG - Intergenic
1149148532 17:53530613-53530635 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1149867893 17:60160900-60160922 AGGAGTAGAGGGAGGGAGGGAGG + Intronic
1149868682 17:60164336-60164358 CAGACTGGAGGGAGGGGAGGAGG - Intronic
1149882955 17:60310995-60311017 AAGAGTAGTGGGGAGGAGGGGGG + Intronic
1150031271 17:61738444-61738466 CTGGGTAGAGGGGAGGAAGGTGG - Intronic
1150169389 17:62976872-62976894 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1150293141 17:63993203-63993225 AAGGGAGGAGGGAAGGAAGGAGG + Intergenic
1150293148 17:63993222-63993244 GAGGGAGGAGGGAAGGAAGGAGG + Intergenic
1150539734 17:66084666-66084688 AAGGGTAGTGGGAAGGCAGGGGG + Intronic
1150772004 17:68050250-68050272 AAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1150772025 17:68050361-68050383 AAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1150908748 17:69366426-69366448 AAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1150960655 17:69908795-69908817 GAGAGTGGTGGGGAGGAAGGTGG - Intergenic
1151151182 17:72088730-72088752 AAGAAGACAGGGAAGGAAGGTGG - Intergenic
1151203201 17:72484112-72484134 GAGAGTAGTGGGAAGGACAGAGG + Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151482326 17:74377678-74377700 AAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1151522977 17:74643921-74643943 TAGAAGAGAGAGAAGGAAGGTGG + Intergenic
1151713165 17:75818184-75818206 CACAGCAGAGGGGAGGAAGGGGG - Intronic
1151820316 17:76493461-76493483 AAGAGTAAAGGGCAGGAAAGTGG + Intronic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152399873 17:80059393-80059415 GGGAGTGGAGGGAACGAAGGGGG + Intronic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1153033019 18:732686-732708 CACAGTAAAGGGAAGGAGTGGGG + Intronic
1153590451 18:6669090-6669112 GAGAGGAGAGGGAGGGAAGGAGG + Intergenic
1154181268 18:12142043-12142065 CAGAGTACTGGGAAGGAACAGGG - Intergenic
1154182636 18:12149541-12149563 CAGAGTACTGGGAAGGAACAGGG + Intergenic
1154447751 18:14449248-14449270 CAGAGGAGAGGCAAGGCCGGTGG - Intergenic
1155058184 18:22204001-22204023 CAGTGTAGTGGGGAGAAAGGTGG + Intergenic
1155149057 18:23108073-23108095 GAGAGTAGAGGGAGGGTGGGAGG - Intergenic
1155331929 18:24727575-24727597 CAGAGTAGAAGGAAAGGCGGCGG - Intergenic
1155473240 18:26212549-26212571 CAAAGGAGAGCAAAGGAAGGTGG - Intergenic
1156042152 18:32834940-32834962 CAGAGAAGAGTGCAGGAAAGGGG + Intergenic
1156045441 18:32872155-32872177 CAGAGAAGAGGGAAGGAAACAGG + Intergenic
1156100239 18:33585110-33585132 AGGAAAAGAGGGAAGGAAGGAGG - Intronic
1156384504 18:36593420-36593442 CAGAGGAGAGGGAAGCAAGGGGG + Intronic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156610688 18:38720396-38720418 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157099983 18:44720650-44720672 GAGAGTACAGGGAGGGATGGAGG + Intronic
1157134035 18:45036705-45036727 GAGAATAGGAGGAAGGAAGGAGG + Intronic
1157166715 18:45364083-45364105 AAGAGTTGAGGGATGGGAGGGGG - Intronic
1157310169 18:46546803-46546825 CACAGGGGAGGGAAGGAAGATGG + Intronic
1157348020 18:46858097-46858119 CAGAGTACAGAGAAAAAAGGCGG + Intronic
1157442525 18:47721686-47721708 CAGAATAAAAGGAAGGAAAGAGG + Intergenic
1157544010 18:48535262-48535284 CAGTGCAGAAGGAAGGAAGTTGG - Intergenic
1157564655 18:48671716-48671738 CAGGGTTGAGGGAAAGTAGGAGG - Intronic
1157745600 18:50132611-50132633 CAGAGAAGAGGGGAGCATGGTGG - Intronic
1157847551 18:51017743-51017765 CAGCACAGAGGGAAGGAAGGGGG + Intronic
1158535396 18:58303965-58303987 CAGAGTGGAGGGGAGGGAGTAGG + Intronic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1159231539 18:65613385-65613407 GAGAAAAGGGGGAAGGAAGGAGG + Intergenic
1159356018 18:67338099-67338121 GAGAGAGGAGGGGAGGAAGGAGG - Intergenic
1159426764 18:68299170-68299192 CAGAGTAGATGGGTGGGAGGGGG - Intergenic
1159648415 18:70947686-70947708 GAGAGTAGAGGGTAGGAGGAGGG + Intergenic
1159918838 18:74209403-74209425 TAGAGCAGAAGGAGGGAAGGAGG - Intergenic
1160019922 18:75172495-75172517 GAGAGTAGGAGGAAGGAAGCGGG + Intergenic
1160427202 18:78786860-78786882 TGCAGGAGAGGGAAGGAAGGCGG + Intergenic
1160983277 19:1826469-1826491 CAGAGATGGGGGAAGGGAGGAGG + Intronic
1161139694 19:2639993-2640015 AAGAAGAGAGGGAGGGAAGGAGG + Intronic
1161280366 19:3442337-3442359 CAGAGGAGAGGAATGGATGGGGG - Intronic
1161465964 19:4430637-4430659 CAGAGGTGAGGGAGTGAAGGGGG + Exonic
1161599839 19:5174898-5174920 AAGAAAAGAGGGACGGAAGGAGG - Intronic
1161754162 19:6119421-6119443 GAGAGGAGAGGGAGGGAGGGAGG - Intronic
1161834457 19:6636381-6636403 GAAAGGAGAGGGAAGGAGGGAGG - Intergenic
1161834484 19:6636466-6636488 AAAAGTTGAAGGAAGGAAGGAGG - Intergenic
1161852539 19:6745126-6745148 CGGACTGGAGGGAAGGAAGGCGG + Intronic
1161913909 19:7214837-7214859 GAGGGAAGAAGGAAGGAAGGAGG - Intronic
1162265975 19:9574659-9574681 CAGAGGAGAAGAAAGGAAGGAGG + Intronic
1162281415 19:9700819-9700841 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162671289 19:12259935-12259957 AAGAGGACAGGGAGGGAAGGTGG - Intronic
1162761518 19:12891412-12891434 GAGTGTGGAGGGAAGGAGGGAGG + Intronic
1163018284 19:14470014-14470036 CAAAGGAGGGGGAAGGAATGGGG + Intronic
1163084372 19:14968754-14968776 TGGAGTAGAGGGAAGGCAGTAGG - Intronic
1163462554 19:17447954-17447976 TAGAATGGAGGGAGGGAAGGAGG + Intronic
1163472701 19:17506573-17506595 GAGAGGAGAGGGAGGGAGGGAGG + Intergenic
1163491197 19:17618068-17618090 AAGGGTAGAGGGAAGGATGGGGG - Intronic
1163946305 19:20538367-20538389 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1163973087 19:20819458-20819480 CAGAGGAGAATGAAGGAAGGAGG + Intronic
1163984850 19:20936620-20936642 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1164014127 19:21237050-21237072 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1164523066 19:28993584-28993606 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1164585819 19:29475233-29475255 GAGAAGAGAGGGGAGGAAGGAGG + Intergenic
1164729759 19:30494583-30494605 TAGGTTAGATGGAAGGAAGGAGG - Intronic
1164737226 19:30550626-30550648 GAAAGAAAAGGGAAGGAAGGGGG + Intronic
1164771914 19:30816138-30816160 AGGAAGAGAGGGAAGGAAGGAGG - Intergenic
1164895185 19:31870651-31870673 AATAGTAGGGGGAAGAAAGGGGG - Intergenic
1164916771 19:32058304-32058326 GAGGGAAGAAGGAAGGAAGGAGG - Intergenic
1164937087 19:32223404-32223426 AAGGATAGAGGGAAGGAGGGAGG + Intergenic
1165205299 19:34179686-34179708 AATAGTAGAAGGAAGGAAGTAGG + Intronic
1165261542 19:34623454-34623476 CAGAGGAGATGGGAGGAAAGAGG - Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165700463 19:37933309-37933331 GAGACTTGAGGGAAGGAGGGAGG - Intronic
1165844271 19:38808262-38808284 GAGGGAAGGGGGAAGGAAGGAGG + Intronic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166154909 19:40903690-40903712 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1166329584 19:42070223-42070245 GAGAGAAGAGGGAGGGAGGGAGG + Intronic
1166411627 19:42559404-42559426 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1166505890 19:43371365-43371387 CAGAGGAGAGGAAAGGGAAGAGG - Intergenic
1167195386 19:48024565-48024587 TAGAGGAGAGGGAAAGGAGGGGG + Intronic
1167319515 19:48787640-48787662 CAGAGGAGAACAAAGGAAGGGGG + Intergenic
1167383272 19:49150471-49150493 CAAAGTAGAGAAAAGGAAAGCGG - Exonic
1167391975 19:49201303-49201325 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1167413144 19:49356692-49356714 AGGAGCAGAGGGAAGGGAGGGGG + Intronic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167724296 19:51200247-51200269 GAGGGGAGAGGGAAGGATGGGGG - Intergenic
1167789707 19:51666644-51666666 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1168240075 19:55084464-55084486 CAGACTGGAGGGAAGCAACGTGG + Intronic
1168661489 19:58170874-58170896 AAGAATAGAGGGAAGAGAGGAGG + Intergenic
924971880 2:135898-135920 CAGAGCAGGAGGAAGGGAGGAGG - Intergenic
925034233 2:673719-673741 CAGAGGGGAGGGGAGGGAGGAGG + Intronic
925222879 2:2156670-2156692 CAGAGGTGAAGGAAGGAAGGAGG + Intronic
925299430 2:2800133-2800155 GAGGGAAGGGGGAAGGAAGGAGG + Intergenic
925660299 2:6195228-6195250 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
925789945 2:7474164-7474186 CACAGTGGAGGGAAGGAATTGGG - Intergenic
925913769 2:8589713-8589735 GAGAGGGGAGGGAAGGAAAGGGG + Intergenic
925965898 2:9065665-9065687 CAGAGTTGAGGGAAGAATGGTGG - Intergenic
925970256 2:9101613-9101635 CAGGGTAGAGGAAAATAAGGGGG - Intergenic
926115867 2:10213044-10213066 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
926369002 2:12161724-12161746 GAGAGGAGAGGAAAGAAAGGCGG - Intergenic
926726755 2:16004611-16004633 CAGAGTAGAGGCAGGCAAGGTGG - Intergenic
927061843 2:19430417-19430439 CAGTATACAGGGAAGGAAGTTGG + Intergenic
927089903 2:19702502-19702524 CGTAGTAGAGGGAAAGAAGAAGG - Intergenic
927343138 2:22005507-22005529 AGGAAGAGAGGGAAGGAAGGAGG - Intergenic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
927642193 2:24852401-24852423 CAGAGAAGAGGGAGCGGAGGAGG + Intronic
927852817 2:26510750-26510772 CTGAGTAGGGGGAAGAAATGAGG + Intronic
927934886 2:27070853-27070875 CAAACTATAGAGAAGGAAGGGGG - Intronic
927962942 2:27251855-27251877 TCGAGGAGAGGGAAGGAGGGTGG - Intergenic
928102965 2:28450111-28450133 CAGAGGAGGGGGAAAGAAGGAGG - Intergenic
928270366 2:29849809-29849831 GAGAGGAGAGGGGAGGAGGGAGG + Intronic
928373788 2:30759207-30759229 GAGAGAAGAGGGAAGGCAGGGGG - Intronic
928448127 2:31350913-31350935 GAGACTAGAAGGAAGGAAAGTGG - Intronic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
928770070 2:34695409-34695431 CAGGCGAGAGGGAAAGAAGGAGG - Intergenic
928778192 2:34791267-34791289 CAGGCAAGAGGGAAAGAAGGAGG - Intergenic
929071691 2:38038046-38038068 GGGAGAAGAGGGAAGGAAGATGG - Intronic
929294068 2:40226590-40226612 TAGAGTGGAGGGAAGCAAGGTGG - Intronic
929451993 2:42044112-42044134 GAGAGAGGAGGGAAGGAAGGAGG + Intergenic
929471323 2:42196856-42196878 CACAGTAGAGGGCAGGGTGGAGG - Intronic
929489635 2:42384858-42384880 CAGAGCTGGGGGAAGGCAGGTGG - Intronic
929781925 2:44962585-44962607 CAGAGGTGGGGGTAGGAAGGAGG - Intergenic
929891703 2:45923797-45923819 AGGAGCAGAGGGAAGGAGGGAGG + Intronic
929918100 2:46153000-46153022 CAGAGGGGAGAGAAGGAATGAGG - Intronic
929929974 2:46246419-46246441 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931150618 2:59568941-59568963 CAGAGTAGAGGTCATGAAAGTGG - Intergenic
931371962 2:61671999-61672021 CACAGAAGAGGCAAGGAAAGTGG + Intergenic
931451751 2:62373217-62373239 CAGAGGAGAACAAAGGAAGGTGG + Intergenic
931529971 2:63202842-63202864 CACAGACAAGGGAAGGAAGGAGG - Intronic
931553024 2:63468168-63468190 GAAAGGAGAGAGAAGGAAGGAGG - Intronic
931561714 2:63568720-63568742 CAGAGGAGAACAAAGGAAGGAGG + Intronic
931677845 2:64715951-64715973 GAGATTAGGGGGTAGGAAGGTGG - Intronic
932094061 2:68831381-68831403 GAGAACAGAGAGAAGGAAGGAGG - Intergenic
932486843 2:72089309-72089331 GAGAGTGGAAGGAAGGAGGGAGG + Intergenic
932559094 2:72851496-72851518 GATAGCAGAGGGGAGGAAGGCGG - Intergenic
932571646 2:72941453-72941475 CAGAGAAGCGGGCAGGGAGGTGG - Intergenic
932768016 2:74483303-74483325 CAGTCTACAGGAAAGGAAGGCGG - Exonic
932841601 2:75088310-75088332 GCGTGGAGAGGGAAGGAAGGAGG - Intronic
933160190 2:79015324-79015346 CAGAGTGGAGGAGAGGAAGATGG - Intergenic
933521247 2:83377202-83377224 AGGAGTTAAGGGAAGGAAGGAGG - Intergenic
933946267 2:87288614-87288636 AAGAATGGAGGGAGGGAAGGAGG - Intergenic
934069971 2:88374721-88374743 CAGAGAAGAGGAGAAGAAGGTGG + Intergenic
934319622 2:91960653-91960675 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
934468007 2:94283663-94283685 AAGAGGCGAAGGAAGGAAGGAGG - Intergenic
934589814 2:95537044-95537066 AAGAATGGAAGGAAGGAAGGAGG + Intergenic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
934916878 2:98307402-98307424 CAGAGGAGAGCAAAGGAAGGAGG + Intronic
934955748 2:98616905-98616927 GAGGGTAGAGCGAAGAAAGGTGG + Intronic
935044742 2:99470653-99470675 CAGAGGAGAACAAAGGAAGGAGG - Intronic
935155385 2:100479663-100479685 AAGAGGAGAGGGATGGAAGCAGG - Intronic
935210874 2:100938582-100938604 CAGAGAGGAGGGAGGGAGGGAGG - Intronic
935422761 2:102886993-102887015 CAGAGAAGAAGGGAGGGAGGAGG - Intergenic
935516662 2:104048882-104048904 GAAAGTAAAAGGAAGGAAGGAGG - Intergenic
935626657 2:105177262-105177284 GAGAGAAGGAGGAAGGAAGGAGG - Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935787202 2:106560025-106560047 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
936453533 2:112651990-112652012 AAGAGGAGAGTGATGGAAGGGGG - Intronic
936483969 2:112910868-112910890 CAGAGGAGAGTGAAGGAAAGAGG - Intergenic
936835391 2:116703594-116703616 GTGAGTAGAGGGAAGGGTGGAGG - Intergenic
936845028 2:116821018-116821040 CAAAGCAGATGGAAGAAAGGGGG - Intergenic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936957884 2:118041378-118041400 CAGAGTAGAGGCAATGGATGAGG - Intergenic
937031066 2:118741056-118741078 CAGAGTATAGCCAGGGAAGGAGG + Intergenic
937088616 2:119189610-119189632 CATGGTGGAGGGATGGAAGGTGG - Intergenic
937227164 2:120376503-120376525 CAGAGGAGAAGGGAGGAAGGAGG - Intergenic
937392328 2:121500432-121500454 AAGAAAAGAGGGAAGGAAGGAGG + Intronic
937400836 2:121582224-121582246 GGGAGCAGAGGGAGGGAAGGAGG + Intronic
937448179 2:121976045-121976067 AAGAGGAGAGGTGAGGAAGGAGG + Intergenic
937514211 2:122634490-122634512 GAGAGTAGAGGCTTGGAAGGAGG + Intergenic
937688530 2:124725482-124725504 GAGAGGAGAGGAAAGGAAGGGGG - Intronic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937726576 2:125174427-125174449 CAGAATAGAACAAAGGAAGGAGG - Intergenic
937920002 2:127122221-127122243 CAGAGGAGAGGGCAGGTTGGAGG - Intergenic
938192422 2:129295869-129295891 TAAAGTAGAAGGAATGAAGGTGG - Intergenic
938264661 2:129918639-129918661 AAGAAAAGAGGGAGGGAAGGAGG + Intergenic
938314717 2:130317709-130317731 CAGGGAAGAGGGAAGGCATGAGG - Intergenic
938664894 2:133524612-133524634 GAGAGCAGTGGGAAGAAAGGAGG - Intronic
938739851 2:134220721-134220743 CAGACTAGAGCAAAGGAAAGAGG - Intronic
938772005 2:134508733-134508755 GAGAGTTGAGGGAAGAAATGAGG - Intronic
938800533 2:134759530-134759552 CAGAACAGAAGGAAGGAAGGGGG + Intergenic
938845731 2:135206776-135206798 AAGGATAGAAGGAAGGAAGGAGG + Intronic
938938932 2:136152218-136152240 AAGGAGAGAGGGAAGGAAGGAGG - Intergenic
938977571 2:136494542-136494564 CAGAGAAGAGGGATGGATGGGGG + Intergenic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939670270 2:145002280-145002302 CAGATTCTAGGGAAGCAAGGGGG + Intergenic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
940039043 2:149340471-149340493 CAATGTAGAGGGAAGGTTGGAGG + Intronic
940770560 2:157835197-157835219 CACAGTGTAGGGGAGGAAGGGGG - Intronic
941158595 2:162008983-162009005 AAGAGGGAAGGGAAGGAAGGAGG - Intronic
941347580 2:164389343-164389365 GAGAGGAGAGGGAGGGAGGGAGG - Intergenic
941465192 2:165817249-165817271 AGGAGAAGAAGGAAGGAAGGAGG + Intergenic
941506587 2:166353676-166353698 TATATTTGAGGGAAGGAAGGAGG - Intronic
941687954 2:168467048-168467070 AAGAAGAGAGGGAAGGAAGGTGG - Intronic
942354948 2:175100746-175100768 CAGAGGAGAACAAAGGAAGGAGG - Intronic
942502056 2:176601727-176601749 CAGAGTAGAGGGCTGGAAATTGG - Intergenic
942572113 2:177324970-177324992 CAGAGTAGAGGTGAGTAATGTGG - Intronic
942703184 2:178737106-178737128 TAGAGAGGAGGGAGGGAAGGAGG + Intronic
942910748 2:181241550-181241572 GAAAGTAGAGGGAGGGAGGGAGG - Intergenic
943208204 2:184928011-184928033 AAAAGTAGAGAGAAGGAAAGGGG - Intronic
943585545 2:189735090-189735112 CAGAGTAGAGGGGCAAAAGGTGG - Intronic
943633433 2:190279828-190279850 CAGAGGAGAACAAAGGAAGGAGG - Intronic
943702736 2:191004135-191004157 CAGGGTGGAGGGAAGCAGGGAGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944116248 2:196190007-196190029 AAGAGTACAGCAAAGGAAGGAGG - Intergenic
944514299 2:200496425-200496447 CAAAGTTGAGGAAAGGAAGAAGG + Intronic
944581501 2:201136894-201136916 CTGAGGAGAGGGCAGGAATGGGG + Intronic
944775585 2:202960790-202960812 GAAAGAGGAGGGAAGGAAGGAGG - Intronic
944970302 2:204985178-204985200 CAGGCAGGAGGGAAGGAAGGAGG - Intronic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945222769 2:207501661-207501683 CAGAATAGAGGGGAGTAAGGAGG + Intergenic
945416809 2:209583915-209583937 AAGCGCAGAGGGAAGGAAGGAGG - Intronic
945520722 2:210824049-210824071 CAGAGAAGAGGGAGGAAAAGAGG - Intergenic
945624687 2:212188251-212188273 GAGAGAAGAGGGAGGGAGGGAGG - Intronic
945898796 2:215514965-215514987 AGGAGTAGAGGGAAGGGAAGGGG + Intergenic
946153150 2:217789673-217789695 CAGAGAGGAGGGAAGGCAGAGGG + Intergenic
946174492 2:217914069-217914091 AAGAGAGGAGGGAAGGAGGGAGG - Intronic
946250489 2:218408420-218408442 CAAAAAAGAGGAAAGGAAGGAGG + Intergenic
946281547 2:218669470-218669492 AAGGAAAGAGGGAAGGAAGGAGG + Intronic
946418217 2:219551151-219551173 CTGGGCAGAGGGCAGGAAGGAGG + Intronic
947006032 2:225512545-225512567 GAGGGAAGAAGGAAGGAAGGAGG - Intronic
947138261 2:226996296-226996318 CAGAGTAGAGCGAAGGCATTTGG + Exonic
947331670 2:229035451-229035473 GTGAGTAGAGGGAAGGAGGGGGG - Intronic
947370852 2:229444165-229444187 GAGAATAGACGGAAGGAAAGTGG + Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947669221 2:231926059-231926081 CAGGAGAGAGGGAAGGCAGGCGG - Intronic
947913869 2:233819526-233819548 CAGATGAGAGGGAAGGACGAGGG + Intronic
948029993 2:234809590-234809612 AGGAGGAGAGGAAAGGAAGGAGG - Intergenic
948032428 2:234829898-234829920 CAGAAATGAAGGAAGGAAGGAGG - Intergenic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948287404 2:236796601-236796623 GAAAGAAGAAGGAAGGAAGGAGG - Intergenic
948311889 2:236993527-236993549 GAAAGTAGGGGGAAGGAAGGAGG + Intergenic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948458011 2:238116258-238116280 AAGAGGGGAGGGAAGGAAGCTGG - Intronic
948806266 2:240454527-240454549 CTGAGTAGAGGGCAGGAGCGGGG + Intronic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
948960315 2:241329804-241329826 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1168831185 20:846059-846081 CAGAGGCCAAGGAAGGAAGGAGG - Exonic
1168842241 20:916906-916928 GAGAGCAGAGGGAGGGGAGGAGG + Intergenic
1169497262 20:6127240-6127262 AGGAGAAGAGGGATGGAAGGAGG - Intergenic
1169554623 20:6736195-6736217 CAGAGGAAAGGGAAGGAACTAGG - Intergenic
1169754898 20:9033351-9033373 GAGAGTACAAGGAAGGAAGAGGG - Intergenic
1170268759 20:14499800-14499822 AAGAAAAGAAGGAAGGAAGGAGG - Intronic
1170522077 20:17197146-17197168 AGGAAAAGAGGGAAGGAAGGAGG + Intergenic
1170544213 20:17420010-17420032 CAAAATGGAGGGAAGGAAGATGG + Intronic
1170697246 20:18670041-18670063 GAGAGAAGAGGGCAGGAAGAAGG - Intronic
1170709443 20:18777115-18777137 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1170781537 20:19430053-19430075 AGGGGGAGAGGGAAGGAAGGAGG + Intronic
1170881022 20:20296434-20296456 CAGGAAGGAGGGAAGGAAGGAGG - Intronic
1171436960 20:25131392-25131414 CAGAAGAGAGGGAAAGGAGGAGG + Intergenic
1171562690 20:26139871-26139893 CAGAGAAGAGGGAATGAGAGAGG - Intergenic
1171756419 20:29113871-29113893 AAGGAGAGAGGGAAGGAAGGAGG + Intergenic
1171770685 20:29320198-29320220 AAGGAGAGAGGGAAGGAAGGAGG + Intergenic
1171773692 20:29346891-29346913 CAGAATAGTGGGGAGGGAGGCGG - Intergenic
1171785820 20:29463965-29463987 GAAAGAGGAGGGAAGGAAGGAGG - Intergenic
1172306891 20:33887071-33887093 CAGAGAACAGGGAAGGCAGTGGG + Intergenic
1172375323 20:34434353-34434375 AAGAGTATAGTGAAGGAAAGGGG + Intronic
1172587471 20:36094617-36094639 GAGTGTAAAAGGAAGGAAGGTGG + Intronic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172807931 20:37626273-37626295 CGGATGAGAGGGAAGGAAGTGGG + Intergenic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1173635369 20:44551784-44551806 CAGAGTTGAGGTAATAAAGGTGG + Intronic
1173650086 20:44658012-44658034 CAGAGCAGAGAGATAGAAGGAGG - Intergenic
1173722999 20:45276502-45276524 CATAATAGAGGGAAGGACAGGGG + Intergenic
1173773747 20:45685697-45685719 AATAGTAGTGGGAATGAAGGGGG - Intronic
1173865853 20:46312388-46312410 GAGGGGAGTGGGAAGGAAGGAGG - Intergenic
1174174355 20:48635701-48635723 GACAGAGGAGGGAAGGAAGGTGG - Intronic
1174221574 20:48959606-48959628 CAAAATGGAAGGAAGGAAGGAGG - Intronic
1174513749 20:51075476-51075498 AAGAGTAGGGGGAAAGATGGGGG - Intergenic
1174818529 20:53707847-53707869 CTGACCAGTGGGAAGGAAGGTGG + Intergenic
1175695165 20:61097764-61097786 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1175979971 20:62733765-62733787 CAGAGGAGAGAGAGGGGAGGAGG + Intronic
1176293513 21:5058793-5058815 CAGGGAAGAGGGAAGGCAGGAGG - Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176674105 21:9761040-9761062 CAGAGTAGAAGTAATGCAGGAGG - Intergenic
1176719575 21:10382174-10382196 CAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1177604269 21:23358419-23358441 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1177617738 21:23545942-23545964 TAGAGGGGAGGGTAGGAAGGGGG + Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1177848419 21:26318548-26318570 GAGAGTAGAGACAAAGAAGGGGG + Intergenic
1178350639 21:31871067-31871089 CAGGGTAGAGGTCAGGAAAGGGG - Intergenic
1178900190 21:36592361-36592383 CAGAAGAGAGGAAAGGAAGAGGG - Intergenic
1178906571 21:36641980-36642002 CAGAAAAGAGGTAGGGAAGGCGG - Intergenic
1178985723 21:37301166-37301188 TGGAGTAGATGGAAAGAAGGGGG - Intergenic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1179141162 21:38726661-38726683 CAGGAAAGAAGGAAGGAAGGAGG - Intergenic
1179156008 21:38851830-38851852 CTTAGCAGAGGGAAGGAAGCTGG - Intergenic
1179156807 21:38858120-38858142 GAGAGTACAGGAAAGGAAGGAGG + Intergenic
1179365235 21:40752822-40752844 GGGAGAAGAGGGAAGCAAGGAGG + Intronic
1179406050 21:41126804-41126826 AAGGGTAGGGGGAAGGGAGGGGG - Intergenic
1179651554 21:42812657-42812679 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1179863747 21:44204855-44204877 CAGGGAAGAGGGAAGGCAGGAGG + Intergenic
1180282256 22:10712708-10712730 CAGAATAGAGGTAAAGAAGTGGG + Intergenic
1180295190 22:10928286-10928308 AAGGAGAGAGGGAAGGAAGGAGG - Intergenic
1180300812 22:11035148-11035170 CAGAAGAGAGGGAGGGAGGGAGG + Intergenic
1180307873 22:11144698-11144720 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1180319163 22:11305008-11305030 CAGAATAGTGGGGAGGGAGGCGG - Intergenic
1180413470 22:12637726-12637748 AAGGAGAGAGGGAAGGAAGGAGG + Intergenic
1180413490 22:12637799-12637821 AAGGAAAGAGGGAAGGAAGGAGG + Intergenic
1180463980 22:15594260-15594282 AAGAGAGGAGGGAAGGAGGGAGG + Intergenic
1180546349 22:16506511-16506533 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1180659660 22:17455083-17455105 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1181278083 22:21699338-21699360 CAGGGCAGAGGGCAGGCAGGGGG - Exonic
1181381777 22:22510220-22510242 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1181417409 22:22770677-22770699 CAGAGAAAAGGGCAGGGAGGTGG - Intronic
1181423474 22:22817967-22817989 CAGAGCAAAGGGCAGGGAGGGGG - Intronic
1181675667 22:24450049-24450071 CAGGGTAGTGGGTAGGAAAGTGG - Intergenic
1181759974 22:25051599-25051621 CAGAGGAGAGGAAGGGGAGGAGG - Intronic
1181901553 22:26160327-26160349 GGAAGTAGAGGGAAGGAGGGAGG + Intergenic
1182126118 22:27816958-27816980 GAGAAAAGAAGGAAGGAAGGAGG - Intergenic
1182212844 22:28690868-28690890 GAGGGGAGGGGGAAGGAAGGAGG + Intronic
1182458828 22:30470124-30470146 CTGAGAACAGGGATGGAAGGAGG + Intronic
1182624928 22:31638597-31638619 CAGAGGCTAGGGAAGGATGGGGG - Intronic
1182680729 22:32077416-32077438 GAGAGTAGGGGGAAGGATGGAGG - Intronic
1183025905 22:35065914-35065936 CAGAGCAGGGGAAGGGAAGGTGG - Intergenic
1183272064 22:36868497-36868519 CAGAGGAGGTGGGAGGAAGGAGG + Intronic
1183285909 22:36963524-36963546 CAGAGGAGAGGAAAGGGAAGAGG - Intergenic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183503581 22:38195963-38195985 CAAAGTAGAGGGAAGGGAAGAGG + Intronic
1183507842 22:38219244-38219266 CAGAGCAGGGGGCAGGGAGGAGG + Intergenic
1183602640 22:38849021-38849043 TAGAGGAGAGGGAAGGATGGAGG - Intergenic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183698825 22:39438240-39438262 GAGAAGGGAGGGAAGGAAGGAGG - Intergenic
1183698845 22:39438299-39438321 GAGGGGAGAGGGAGGGAAGGAGG - Intergenic
1183751492 22:39723598-39723620 GAGAGGAGAGGGAGGGCAGGAGG - Intergenic
1183832576 22:40426196-40426218 CAGATGAGTGGGAAGGAAGCGGG - Intronic
1184014810 22:41777997-41778019 AGGAGGAGAAGGAAGGAAGGAGG - Intronic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184049630 22:41994823-41994845 CAGAGTTGAGAGGAAGAAGGTGG - Intronic
1184264074 22:43337434-43337456 CAGAGTAGAGGGTCAGAAAGCGG + Intronic
1184420032 22:44374440-44374462 CAGGATAGAGGGCAGGTAGGAGG - Intergenic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1184509358 22:44924073-44924095 GAGGGAAGAGGGGAGGAAGGAGG + Intronic
1184509868 22:44927095-44927117 CAAAGGAGAGGGACGGATGGAGG + Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184887305 22:47354247-47354269 ACGAGCAGAGGGAAGGCAGGAGG - Intergenic
1184888819 22:47367237-47367259 AAGAGTACAGGGAAGGATGAAGG - Intergenic
1184903761 22:47464849-47464871 CAGAGTAAAGGAAAAGTAGGAGG - Intronic
1184931660 22:47685869-47685891 CAGAGAAGAGTGAGTGAAGGAGG + Intergenic
1185035062 22:48470462-48470484 CTGGGTAGAGGGCAGGGAGGGGG - Intergenic
1185229824 22:49673587-49673609 CAGAGGGGGGGGAAGGGAGGAGG + Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949432414 3:3991831-3991853 AAGAAGAGAAGGAAGGAAGGAGG + Intronic
949634444 3:5967574-5967596 GAGGGAAGAAGGAAGGAAGGGGG - Intergenic
949726855 3:7058852-7058874 CAGAGGAGAACAAAGGAAGGAGG + Intronic
949977903 3:9477508-9477530 CAAATTAGAGGGAAGGAAGGAGG - Exonic
950084140 3:10245299-10245321 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
950153303 3:10704845-10704867 CAAAGAAGATGGAAGGGAGGAGG + Intronic
950232626 3:11289903-11289925 CAAAGTACAGGGAAGGAATAAGG + Intronic
950654341 3:14427467-14427489 CAGAGGCCTGGGAAGGAAGGCGG - Intronic
950671317 3:14527436-14527458 GAGGGAAGAGGGAGGGAAGGAGG + Intronic
950907540 3:16552904-16552926 TAGAGAATAGGGAAGAAAGGAGG + Intergenic
950957576 3:17070873-17070895 CAGAGAAGAGGAAATGAAGGAGG + Intronic
951114604 3:18845422-18845444 GAAAGAAGGGGGAAGGAAGGAGG - Intergenic
951376812 3:21928275-21928297 AAGAGAGGAAGGAAGGAAGGAGG + Intronic
951626963 3:24675982-24676004 CATAGTATAGGTAAGTAAGGAGG - Intergenic
952739206 3:36719572-36719594 CAGGGATGAGAGAAGGAAGGAGG - Intronic
952875091 3:37938102-37938124 CAGAGTAGCTGGAATGTAGGTGG - Intronic
952898217 3:38093308-38093330 AGGAAAAGAGGGAAGGAAGGAGG - Intronic
953062434 3:39438533-39438555 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
953098842 3:39806628-39806650 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
953879370 3:46683722-46683744 CAGAGGACAGGGTAGGAAGAGGG - Intronic
954384405 3:50236763-50236785 CAAAGTGTAGGGAAGGATGGCGG - Intronic
954588139 3:51754623-51754645 CAGAGGAGAAGAAAGGAAAGAGG + Intergenic
954759280 3:52862176-52862198 CAGCTGAGTGGGAAGGAAGGAGG - Intronic
954787413 3:53104105-53104127 CAGGGAAGAGGGAAGGAAGTTGG + Intronic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
955029579 3:55203352-55203374 CAGAGAAGAGGGAAGGGGAGAGG + Intergenic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955417292 3:58704534-58704556 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
955433165 3:58871220-58871242 CAGAGTAAAGGCATGGAAGAAGG + Intronic
955596317 3:60594604-60594626 GAGAGGAGAGGGAAGGGAGGAGG - Intronic
955598671 3:60620639-60620661 CAGAGGAGGGGGAGGGAAAGAGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
956740628 3:72272953-72272975 AAGAGTAGAGGGATGGAGGAAGG + Intergenic
956838775 3:73117700-73117722 AAGAAGAGAGGGAAGGAGGGAGG - Intergenic
957080746 3:75633837-75633859 CAGAGAGTAGGGAAGGAAGTCGG - Intergenic
957251456 3:77776124-77776146 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
957283815 3:78189375-78189397 TGAAGTAGAGGGAAGGAATGAGG - Intergenic
957459467 3:80497766-80497788 GAGGGTAGAGGCCAGGAAGGGGG + Intergenic
958133060 3:89454411-89454433 CAGTGTAGAGGGGAAGAAAGAGG - Intronic
958503114 3:94939586-94939608 AAGAGTAAAGGAAAGGAAGAAGG + Intergenic
958783638 3:98573440-98573462 AAGAGGAGAGGCAAAGAAGGAGG - Intronic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959502614 3:107123966-107123988 CTAAGTAGAAGGTAGGAAGGTGG + Intergenic
959539607 3:107523968-107523990 GAGAGAAGAGGGAGGGAAGGGGG + Intronic
959584363 3:108012356-108012378 GAGGGAAGAGGAAAGGAAGGAGG + Intergenic
959788984 3:110333900-110333922 CAGAGTGGAGGGTGGGAAGAGGG + Intergenic
959796276 3:110432410-110432432 GAGGGGAGAGGGAAGGAGGGGGG - Intergenic
959932793 3:112001268-112001290 CAGAGGAGAAGGGAGGCAGGGGG + Intronic
959934154 3:112012295-112012317 CAAAAAAGAAGGAAGGAAGGAGG - Intronic
960297492 3:115961678-115961700 CAGAAGAGAGTGGAGGAAGGAGG - Intronic
960699593 3:120427249-120427271 CAAAGTTCAGAGAAGGAAGGGGG - Intronic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
961074699 3:123971485-123971507 CAGAGGAGAGGAAAGGAAGGTGG - Intronic
961175835 3:124834500-124834522 GGGAGAGGAGGGAAGGAAGGAGG + Intronic
961308982 3:125980993-125981015 CAGAGGAGAGGAAAGGAAGGTGG + Intronic
961345401 3:126260517-126260539 GAGGGAAGAGGGAAGGGAGGAGG - Intergenic
961624664 3:128253636-128253658 GTGAGGAGAGGGAAGGAAAGAGG - Intronic
962022292 3:131513264-131513286 CAGGTGAGAGGGAAAGAAGGAGG + Intergenic
962162602 3:133014578-133014600 CAGAGCAGAGGCAAGGGTGGTGG - Intergenic
962405240 3:135094666-135094688 CAGAGAAGAGGGAAAGCAGGAGG - Intronic
962412382 3:135152580-135152602 AAGGAGAGAGGGAAGGAAGGAGG + Intronic
962516845 3:136160292-136160314 AAAAAAAGAGGGAAGGAAGGAGG + Intronic
962619907 3:137167961-137167983 GAGAGGAGAGGAAAGGAAAGGGG - Intergenic
962791382 3:138814620-138814642 TTGAGTGGAGGAAAGGAAGGTGG - Intronic
962802078 3:138899000-138899022 AAGAAAAGAAGGAAGGAAGGAGG - Intergenic
962838837 3:139215237-139215259 CAGACTTGATGGAAGGAAGCTGG + Intronic
962962699 3:140325724-140325746 TAGAGGAGAAGAAAGGAAGGAGG - Intronic
963009605 3:140756693-140756715 CTGAGTAGAATGAAAGAAGGGGG - Intergenic
963329531 3:143898733-143898755 GAGAGTAGAGGGCAGGAGGATGG + Intergenic
963872068 3:150427794-150427816 AAGAGAAGAAGAAAGGAAGGAGG - Intronic
963947376 3:151161144-151161166 CACAGTAGAGGGAAGATTGGTGG + Intronic
964088364 3:152845682-152845704 GAGAGGAGAGGAAGGGAAGGGGG - Intergenic
964321321 3:155500715-155500737 CAGAGTACTGGCAAGGAGGGTGG - Exonic
964463156 3:156959538-156959560 CAGAGTGGTGGGATAGAAGGTGG - Intronic
964547159 3:157847091-157847113 CAGAATGGAGGGAAGGCAGAAGG - Intergenic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
964661130 3:159121460-159121482 CAAAGCAGAGGGAAAGAAGGGGG + Intronic
965160299 3:165124432-165124454 CAGGGAAGAGGGAAGAAAGAGGG + Intergenic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
966040918 3:175486910-175486932 AAGAGTGGAGGGAGAGAAGGTGG - Intronic
966273771 3:178141214-178141236 GAGGGTGGAAGGAAGGAAGGAGG - Intergenic
966433555 3:179858427-179858449 AAGGGAAGAGGGAAGAAAGGAGG - Intronic
966598028 3:181745000-181745022 AAGGGCAGAAGGAAGGAAGGAGG - Intergenic
966842012 3:184097522-184097544 CAAAGAAGATGGAAGGAAGCTGG + Intronic
966852656 3:184174259-184174281 GAGAGGAGCGGGGAGGAAGGAGG - Intronic
967210230 3:187162040-187162062 AAGGGAAGACGGAAGGAAGGAGG - Intronic
967483827 3:190006856-190006878 CAGAGTAATGGGAAACAAGGTGG + Intronic
967650936 3:191985802-191985824 CAGAGTTGAGGGCAGGTAGTAGG - Intergenic
968361550 3:198150560-198150582 CAGAGGAGAACGAAGGAAGGAGG - Intergenic
968455221 4:694593-694615 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
968591239 4:1460624-1460646 GAGGGAGGAGGGAAGGAAGGTGG - Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968769435 4:2494704-2494726 CAGAGGAGAATAAAGGAAGGAGG + Intronic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969167525 4:5329753-5329775 CAGAATTAAGGCAAGGAAGGGGG - Intronic
969180014 4:5433160-5433182 CAGAGTAGAGGATAGAAAGGAGG + Intronic
969387779 4:6867312-6867334 CAGAGTAGAAGGACGGAGGCAGG + Intronic
969436100 4:7190430-7190452 AAGAGAGGAAGGAAGGAAGGAGG - Intergenic
969480832 4:7446057-7446079 CAGGGAGGAAGGAAGGAAGGGGG - Intronic
969631697 4:8342848-8342870 TAGATTAGAGGGAAGCATGGAGG + Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970852970 4:20623806-20623828 CAGAATAGAGAGAAAGAAAGGGG + Intergenic
970870401 4:20810442-20810464 CAGGGCAGGGGGGAGGAAGGGGG + Intronic
970894156 4:21083283-21083305 CTGAGGAGGGGGAAGGAAAGAGG - Intronic
970979781 4:22082749-22082771 CAGAGGATAGGAAAGGAAGTAGG - Intergenic
970990678 4:22209677-22209699 CAGAAGAGAGGGAGTGAAGGGGG - Intergenic
971059993 4:22957093-22957115 CTGATTGGAGGGAAGGAAGGTGG + Intergenic
971135049 4:23859431-23859453 CAAAGAAGAGGGAAGGAAATTGG + Intronic
971432945 4:26587992-26588014 GACAGTATAAGGAAGGAAGGAGG - Intronic
971487552 4:27175778-27175800 AAGAAAAGAAGGAAGGAAGGAGG - Intergenic
971600508 4:28585753-28585775 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
972377837 4:38489527-38489549 CAGAGTAGAAGGAGGAGAGGTGG - Intergenic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972698167 4:41468255-41468277 CAGGGCAGAAGGAAGAAAGGAGG - Intronic
973173502 4:47174944-47174966 AAGAAAAGAAGGAAGGAAGGAGG - Intronic
973207068 4:47572602-47572624 GAGAGGAGAAGGAAGGAAGTGGG + Intronic
974029507 4:56763519-56763541 AAGAGGAGAGGGAGGGAGGGAGG - Intergenic
974181260 4:58386926-58386948 AGGAGCAGAGGGGAGGAAGGCGG - Intergenic
974552561 4:63397032-63397054 GAAAGTGGAGGGAAGGGAGGTGG - Intergenic
974980799 4:68955099-68955121 CAGAGGAGAACAAAGGAAGGTGG - Intergenic
975007856 4:69312836-69312858 CAGAGGAGAACAAAGGAAGGAGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975289715 4:72663437-72663459 AAGAAGAGAGGGAAGGAAGTAGG - Intergenic
975609125 4:76186441-76186463 CAGAGAAGAGGGAAAGCAAGGGG + Intronic
975660444 4:76683433-76683455 GAGGGTAAAGGCAAGGAAGGAGG - Intronic
975684195 4:76903585-76903607 CAGAGTTGAGGGTTGGCAGGTGG + Intergenic
975878426 4:78871463-78871485 CAGAGTGGAGGGTAGTAAGTAGG + Intronic
975905495 4:79206632-79206654 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
976517139 4:85981961-85981983 CTCTGTAGAGGGAAGGAAAGAGG - Intronic
976907259 4:90254515-90254537 CTGAGTAGAGGAAAGGAACAGGG + Intronic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
977782556 4:100995957-100995979 CAGGCGAGAGGGAAAGAAGGAGG + Intergenic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
977933752 4:102777486-102777508 AAGAAAAGAAGGAAGGAAGGAGG - Intergenic
977960626 4:103081061-103081083 GTGAGAAGAGGGAAGGAAAGGGG - Intronic
978232479 4:106417189-106417211 CAGAGGACAGGGAAATAAGGGGG - Intergenic
978366439 4:107988049-107988071 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978761430 4:112358690-112358712 CAGAGGAGCCGCAAGGAAGGAGG + Intronic
978817869 4:112930068-112930090 AAGGGTAGAGGAATGGAAGGAGG + Intronic
979031718 4:115657517-115657539 AAGAGTAGAGAGAAAGAATGAGG - Intergenic
979352678 4:119663617-119663639 AAGAGGAGAGGAAAGGAAGGAGG - Intergenic
979535673 4:121817852-121817874 GGGAGAAGAGAGAAGGAAGGGGG - Intronic
979888799 4:126064152-126064174 CAGAGGAGAAAAAAGGAAGGAGG + Intergenic
980093652 4:128467661-128467683 CAGAGTACAGGCAAGGAGGGCGG - Intergenic
980214463 4:129833718-129833740 CAGAATGGAGGGATTGAAGGAGG + Intergenic
980240832 4:130172646-130172668 CAGGGTATAAGGTAGGAAGGAGG - Intergenic
980568891 4:134584132-134584154 AAGAGGGGAGGGAAGGAAAGAGG - Intergenic
980609015 4:135132400-135132422 GAAAGAAGAAGGAAGGAAGGAGG - Intergenic
981326260 4:143451308-143451330 CAGAGTCGTGGGGAGGTAGGTGG + Intronic
981592287 4:146376922-146376944 CAGAGGAGAACAAAGGAAGGAGG + Intronic
981622103 4:146712972-146712994 CAGATGAGAGGTTAGGAAGGTGG - Intronic
982398827 4:154943298-154943320 CAGAGGAGAAGGGAGGGAGGTGG + Intergenic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
983197783 4:164826603-164826625 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
983378983 4:166967521-166967543 CAGAATAGAGAGAACAAAGGAGG - Intronic
983904314 4:173168758-173168780 CGGAGGAGGGGGAAGGAGGGAGG + Exonic
984107032 4:175560447-175560469 AAGAGAGGAAGGAAGGAAGGGGG + Intergenic
984241196 4:177221275-177221297 CAGATTAGAGGAAACTAAGGAGG + Intergenic
984966533 4:185144707-185144729 CAGGGTAGAGAGAAGGGAAGAGG - Intronic
985238410 4:187902174-187902196 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
985273392 4:188216134-188216156 AAGAAGAGAGGGAAGGAAGGGGG - Intergenic
985273435 4:188216265-188216287 AAGAAGAGAGGGAAGGAAGGGGG - Intergenic
985273472 4:188216372-188216394 AAGAAGAGAGGGAAGGAAGGGGG - Intergenic
985273552 4:188216628-188216650 AAGAAAAGAGGGAAGGAAGGGGG - Intergenic
985512319 5:319584-319606 AAGGGCAGTGGGAAGGAAGGAGG + Intronic
985670811 5:1205665-1205687 CATAGTGGAGGGAAGGGAGAGGG + Intronic
985771822 5:1816660-1816682 CAGAGCAGAGGGAAGGTAAGAGG + Intergenic
985884201 5:2663800-2663822 AAGAGAGGAGGGGAGGAAGGAGG - Intergenic
986041634 5:3999608-3999630 CAGAGTTCCGGGAAGGGAGGAGG + Intergenic
986283793 5:6345377-6345399 CAGAATAGAGGGAAGCCAGGGGG + Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
986313354 5:6571075-6571097 GAGGGAAGAGGGAAGGAGGGTGG + Intergenic
986315573 5:6584320-6584342 TAGACTAGAGGGAAGGACCGAGG + Intergenic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
986805252 5:11302849-11302871 CAATGTAGAGGGAAGTTAGGAGG + Intronic
987005267 5:13703961-13703983 CACAGCAGAGGGAAGGGAGATGG - Intronic
987299513 5:16585038-16585060 CAGAGGAGAGGAAAAGAGGGTGG + Intronic
987642585 5:20631620-20631642 AAGAGAAGAAGGAAGGAGGGAGG + Intergenic
987967978 5:24901326-24901348 CATAGTAGAGGCAAAGAAGTTGG - Intergenic
988111250 5:26823688-26823710 AAGGGAAGAGGTAAGGAAGGAGG - Intergenic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988452008 5:31352675-31352697 AGGAGTAGAGGGAAGGAAGGAGG - Intergenic
988885117 5:35548097-35548119 CAGAATAGAGTGCAGGAAGAAGG - Intergenic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
989107726 5:37879350-37879372 CAGAGCAGAGGGGCAGAAGGGGG - Intergenic
989272598 5:39550544-39550566 CAGAAGAGAGGGAAGGAAGGAGG + Intergenic
989302794 5:39913768-39913790 CAGAGGAGAAGGGAGAAAGGTGG + Intergenic
989513300 5:42313609-42313631 GAGGGTAGAGGGTAGGAGGGAGG - Intergenic
989526656 5:42461184-42461206 AATAGTGGAGGGAAGGAAGGAGG + Intronic
989735397 5:44697288-44697310 CAGAGTGGGGGGAAGTAAGCAGG - Intergenic
989987954 5:50724847-50724869 CAGAGTGGGAGGGAGGAAGGGGG - Intronic
990822433 5:59857858-59857880 GAGAGCAGAAGGAAGGAAGGTGG + Intronic
990842593 5:60100435-60100457 AAGAGAAGAAGAAAGGAAGGAGG + Intronic
990890911 5:60649091-60649113 CATAGTCGAGGGAATGAAGTGGG - Intronic
990958090 5:61363897-61363919 AAGAATGGAAGGAAGGAAGGAGG - Intronic
991145015 5:63291172-63291194 CAGAGTAGCAGGAAAGAAGAGGG - Intergenic
991181631 5:63758154-63758176 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
991299860 5:65119832-65119854 CAATCAAGAGGGAAGGAAGGAGG - Intergenic
991429653 5:66530973-66530995 CAGAGTGGAGGAAAAGAAGATGG + Intergenic
991461592 5:66864461-66864483 GAGAGTAGAGGGAAGGGCAGGGG + Intronic
991692383 5:69237501-69237523 CAAAGCATAGGGAAGGAGGGAGG - Intronic
992074263 5:73176448-73176470 AAGAGGAGAGGGCAGGAGGGAGG + Intergenic
992255925 5:74921020-74921042 AGGAAGAGAGGGAAGGAAGGAGG + Intergenic
992595319 5:78340873-78340895 CAGGGGAGAGGGAAGAATGGGGG - Intergenic
992602214 5:78413930-78413952 AAGAGAAGAGGGAGGGAAGGGGG - Intronic
992873141 5:81025963-81025985 GAGGGAAGAGGGAAGGAAGGAGG - Intronic
992879416 5:81091354-81091376 AAGAGGAGAGTGAATGAAGGAGG - Intronic
993050413 5:82920000-82920022 CAGGGTAAAGGAAAGGAAAGGGG - Intergenic
993179940 5:84539829-84539851 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
993677959 5:90840156-90840178 GAGAGTAGAGAGAAGGCAGAGGG - Intronic
993775725 5:91993285-91993307 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
993969365 5:94398001-94398023 GAGGGAGGAGGGAAGGAAGGAGG - Intronic
994013448 5:94936894-94936916 CAGAGGAGAGGGGAGAAAGGAGG - Intronic
994055355 5:95408106-95408128 GAGAGAGGAGGGAAGGAGGGAGG + Intronic
994084584 5:95744045-95744067 GAGAGAAGAGGGAAGGAGAGAGG - Intronic
994221355 5:97198776-97198798 GAGACTAGAGGGAAGAAAGAGGG - Intergenic
994731058 5:103490713-103490735 AAGGGTGGTGGGAAGGAAGGAGG - Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995147441 5:108802499-108802521 GAGGGGAGAGGGAAGGACGGGGG - Intronic
995416039 5:111914459-111914481 CAGAGGAGAACAAAGGAAGGAGG - Intronic
995566942 5:113440619-113440641 GAGAGAAGAGGGAAGGAATAAGG + Intronic
995838535 5:116421802-116421824 TAGAGCAGAAGGAGGGAAGGGGG + Intergenic
995992893 5:118264106-118264128 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
996235954 5:121129039-121129061 CAGAGTAGGAGGAAGAAAAGTGG - Intergenic
996339209 5:122417679-122417701 CAGAATGGAAGGAAGAAAGGAGG - Intronic
996346182 5:122491118-122491140 AAGAGAGGAAGGAAGGAAGGAGG - Intergenic
996387583 5:122925219-122925241 AAAAGAAGAGGGAGGGAAGGGGG - Intronic
996556275 5:124782250-124782272 CAGGGTAGAGTGAAGCAAAGTGG - Intergenic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
997046623 5:130326725-130326747 GAGGGTAGAAGGTAGGAAGGAGG - Intergenic
997208860 5:132066197-132066219 AAAAGCACAGGGAAGGAAGGAGG + Intergenic
997253249 5:132407620-132407642 AAGAGAAGAGGGAAGGATGGAGG + Intergenic
997441510 5:133911844-133911866 CAGAGTGGAAGGAAGTAAGATGG - Intergenic
997535003 5:134613102-134613124 CAGAGGAGAACAAAGGAAGGAGG - Intronic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
997897131 5:137729042-137729064 GAATGTAGAGGGAAGGAAAGTGG + Intronic
997976456 5:138444371-138444393 CAGAGTACAGGGCAGGGAGTTGG - Intronic
998243157 5:140469094-140469116 GAGAAGGGAGGGAAGGAAGGAGG - Intronic
998333154 5:141347023-141347045 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
998333165 5:141347083-141347105 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
998452759 5:142247361-142247383 AAGAAAAGATGGAAGGAAGGAGG - Intergenic
998606235 5:143637852-143637874 AAGAGTAGAGGGAAGCCAGGAGG - Intergenic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
998835229 5:146196823-146196845 CACATTTGAGGAAAGGAAGGAGG - Intergenic
998859973 5:146432985-146433007 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
998891911 5:146755161-146755183 GAGAGGAGAGGGATGGAGGGTGG + Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999178025 5:149645720-149645742 AAGAAAAGAGGGAAGGCAGGAGG - Intergenic
999298582 5:150476101-150476123 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
999346996 5:150832226-150832248 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
999486555 5:152002878-152002900 GGGGGTAGAGGGAGGGAAGGGGG - Intergenic
999528593 5:152436371-152436393 CACAGGAGAGAGAATGAAGGAGG - Intergenic
999580531 5:153033464-153033486 CAGAGAAGAACAAAGGAAGGAGG + Intergenic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
999878756 5:155837605-155837627 AACAGAACAGGGAAGGAAGGAGG - Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
999956595 5:156709848-156709870 CAGAGTAGGGGGCGGGAGGGTGG - Intronic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1000327933 5:160186459-160186481 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1001084730 5:168692306-168692328 GAGAGGAGAGGCAAGGAAGAAGG + Intronic
1001408725 5:171495344-171495366 GGGAGTCGAAGGAAGGAAGGAGG + Intergenic
1001530793 5:172460086-172460108 GAGAGAAGATGGAATGAAGGAGG - Intergenic
1001658013 5:173368818-173368840 GAGATTAGAGGGATGGGAGGAGG + Intergenic
1001710208 5:173772389-173772411 CAGAAAGGAGGGCAGGAAGGAGG - Intergenic
1001802928 5:174559022-174559044 TGGAGTGGAAGGAAGGAAGGAGG - Intergenic
1001946900 5:175786750-175786772 AAGAACAGAGGGAAGGAGGGAGG - Intergenic
1002193505 5:177490655-177490677 GAGGGAGGAGGGAAGGAAGGAGG + Intronic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1002893186 6:1355727-1355749 CGCATTAGAAGGAAGGAAGGAGG + Intergenic
1002899470 6:1398988-1399010 CAGAGAAAAGGCAAAGAAGGGGG + Intergenic
1002924293 6:1595840-1595862 GAGAGAAGAGGGTGGGAAGGCGG - Intergenic
1003095206 6:3137219-3137241 CCGAGCAGAGGGAGGGAGGGAGG + Intronic
1003228488 6:4227878-4227900 AAGGGTAGTGGGAAGGAGGGAGG + Intergenic
1003298120 6:4852335-4852357 AAGATTGGAAGGAAGGAAGGAGG - Intronic
1003298134 6:4852397-4852419 AAGATTGGAAGGAAGGAAGGAGG - Intronic
1003377773 6:5595052-5595074 CACCGTAGAGTGCAGGAAGGGGG + Intronic
1003475601 6:6479279-6479301 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1003674717 6:8192669-8192691 CTGAGTGGAGCCAAGGAAGGGGG + Intergenic
1003872204 6:10412419-10412441 GAGAGGGGAGGGAGGGAAGGAGG + Intronic
1003973170 6:11318346-11318368 TAGAAAAGAAGGAAGGAAGGAGG + Intronic
1004576962 6:16905850-16905872 CACAGAAGAGGGAAGGAAGCTGG - Intergenic
1004725619 6:18308788-18308810 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1004821825 6:19375548-19375570 AAGAAGAGAGGGAAGGAAGAAGG - Intergenic
1004903239 6:20212541-20212563 CCGAGAGGAGGGAAGGAGGGAGG + Intergenic
1005086356 6:22010992-22011014 CAGAGTTGGGGGAAGTAAGGGGG + Intergenic
1005112120 6:22293777-22293799 AAGGGAAGAAGGAAGGAAGGAGG + Intronic
1005497282 6:26398806-26398828 CAGGGAAGATGGGAGGAAGGAGG - Intergenic
1005572291 6:27157098-27157120 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1005909292 6:30294140-30294162 CAAGGTAGTGGGCAGGAAGGGGG + Intergenic
1006057910 6:31399622-31399644 GAGAAAAGAGGGAAGGATGGGGG - Intergenic
1006112065 6:31753447-31753469 CAGGGTGGAGGGCAGGGAGGTGG + Intronic
1006113468 6:31762857-31762879 CAGATTAGAGGGAAGACAGAGGG + Exonic
1006191777 6:32213875-32213897 GAGAGCGGAGGGAGGGAAGGAGG - Intronic
1006299801 6:33187648-33187670 CAGAGTAGATGGAAGCAAATGGG + Intronic
1006407600 6:33854386-33854408 CTGGGTCGGGGGAAGGAAGGAGG - Intergenic
1006524102 6:34589101-34589123 AAGACTTGAGGGAAGGAGGGGGG + Exonic
1006669465 6:35720606-35720628 CTGAGTAAAGGGAAGGGAAGAGG + Intronic
1006810714 6:36818739-36818761 TGGAGTAGAGGGAAGACAGGTGG - Intronic
1007151425 6:39696132-39696154 GGGAGTGGAGGGGAGGAAGGAGG + Intronic
1007236293 6:40393122-40393144 CAGAGGAGAGGGGAGGAGGGAGG + Intronic
1007273774 6:40658603-40658625 CAGAGGGGAGGGAAGGACAGGGG - Intergenic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007377474 6:41466663-41466685 AAGAGAAGGGGGGAGGAAGGAGG + Intergenic
1007981721 6:46166212-46166234 GAGAGAGGAGGGAGGGAAGGAGG - Intronic
1008591416 6:52997069-52997091 CAGATCAAAGGGAAGGGAGGAGG + Intergenic
1008722048 6:54366581-54366603 TAGAGAAGAGGGAGGGAGGGAGG + Intronic
1008850323 6:56014968-56014990 CAGGCAAGAGGGAATGAAGGAGG + Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009292915 6:61906539-61906561 AAGAATAGTGGGAAGGAGGGGGG - Intronic
1009297256 6:61967623-61967645 CAGAGTGGAGGTAAGCAAGTCGG + Intronic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1010050229 6:71495408-71495430 CAAAGAATGGGGAAGGAAGGTGG + Intergenic
1010689490 6:78891854-78891876 AAAAGGAGAGGGAAAGAAGGGGG - Intronic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1010874090 6:81079823-81079845 CAGATTAGAGAGACGGAAAGTGG + Intergenic
1011000544 6:82583519-82583541 CAGAGGAGAGTGAAGGAACAGGG + Intergenic
1011419470 6:87155996-87156018 CCGAGTTCAGGGAAGGAAAGGGG - Intronic
1011658922 6:89577287-89577309 CAGAGTTGAGAGAAGTTAGGAGG - Intronic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1012312977 6:97751169-97751191 AAAGGGAGAGGGAAGGAAGGAGG + Intergenic
1012971667 6:105738084-105738106 CAGAGTAGAGACAAGGGGGGTGG - Intergenic
1013059676 6:106620962-106620984 CAGAAGGGAGGGCAGGAAGGGGG - Intronic
1013365391 6:109433798-109433820 CAGAGGAGAAGGGAGGGAGGGGG + Intronic
1013392999 6:109705509-109705531 CAGAGTGGAGGGAAAGAAATGGG - Intronic
1013576093 6:111484061-111484083 AGGACGAGAGGGAAGGAAGGGGG - Intergenic
1013673069 6:112426811-112426833 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1013721892 6:113040201-113040223 CAAAGAAGAGAGAAGCAAGGAGG - Intergenic
1013891560 6:115033166-115033188 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1013898978 6:115129552-115129574 CAGAGTAGTTGGAAGGAAACAGG + Intergenic
1014020715 6:116585498-116585520 CAGAGTAGAGAGTAGGGAGGGGG + Intronic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014378133 6:120702791-120702813 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1014378138 6:120702810-120702832 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1014982582 6:127962581-127962603 GAGAGTAAAGGGAAGGAAAATGG - Intergenic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1015788474 6:136942629-136942651 CAGTGTAGAGGGAAGGAAACAGG - Intergenic
1015816602 6:137217984-137218006 CAGACTAGTGGAAAGCAAGGCGG - Intronic
1015863174 6:137701712-137701734 CAGAGAAGAGGAAAGTGAGGAGG + Intergenic
1016017403 6:139200176-139200198 TAGAAGAGAGGGAAGGAAGGTGG - Intergenic
1016068653 6:139710711-139710733 TGGAGTAGAAGCAAGGAAGGGGG + Intergenic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016536412 6:145111681-145111703 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1016567419 6:145472017-145472039 GAGAGGAGAGGGAAGGAGTGGGG + Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016751402 6:147634312-147634334 CAGAGCAGAAGGAAGAAAGGAGG + Intronic
1016921309 6:149297090-149297112 AAGAAGAGAGGGAAGGAAGGAGG - Intronic
1016981714 6:149860744-149860766 GAGGGTAGAGGTAGGGAAGGCGG - Intronic
1016998139 6:149975489-149975511 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1017070272 6:150569988-150570010 AAGAGTAGAGGGGAGAAAGTTGG - Intergenic
1017111797 6:150939642-150939664 CGCAGTAGAGAGAAGGCAGGTGG - Intronic
1017319686 6:153075427-153075449 CAGGGTAGAGGTAGGGATGGGGG - Intronic
1017445813 6:154506300-154506322 GAGAGGAAAGGGGAGGAAGGAGG + Intronic
1017483613 6:154882359-154882381 CAGACTTGAGGGAGGAAAGGAGG + Intronic
1017727799 6:157287674-157287696 CAGAAGGGAGGGAAGGGAGGAGG - Intergenic
1017743499 6:157427093-157427115 GAGAAGAGAGGGAAGGAAGAGGG + Intronic
1017891117 6:158640115-158640137 CACAGCAGGGGGCAGGAAGGTGG - Intronic
1017996776 6:159538410-159538432 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1018193423 6:161331989-161332011 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1018230956 6:161674880-161674902 AAGAGTCAAGGGTAGGAAGGAGG + Intronic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018433876 6:163744256-163744278 CAGGGGAGAGGCAAGGAGGGAGG - Intergenic
1018602787 6:165563186-165563208 CAGGGGAGAGGCAAGGGAGGGGG + Intronic
1018671627 6:166182535-166182557 GAGAGTGGAGGGTAGGAAGAAGG - Intergenic
1018885764 6:167935130-167935152 GAGAGGAGAGAGAAGAAAGGAGG - Intronic
1019195285 6:170277883-170277905 AACAGGAGAGGGAAGGGAGGTGG - Intergenic
1019254135 7:38160-38182 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1019416742 7:931136-931158 AAGACAGGAGGGAAGGAAGGAGG + Intronic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019825287 7:3279453-3279475 CAGAGCAGAGGGAAAGAGAGAGG + Intergenic
1019932108 7:4230464-4230486 GAGGGCAGGGGGAAGGAAGGAGG + Intronic
1019937723 7:4267286-4267308 AAGAAGGGAGGGAAGGAAGGAGG - Exonic
1019946739 7:4335711-4335733 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1020000549 7:4753357-4753379 CAGAGGAAAGGGCAGCAAGGCGG + Intronic
1020092316 7:5348641-5348663 AGGAGTAGAGGGAGGGAGGGAGG + Intronic
1020123314 7:5517981-5518003 CAGATTATAGGGAAAAAAGGAGG - Intergenic
1020672093 7:11128781-11128803 AAGAGTAGTGAGAAAGAAGGAGG - Intronic
1020738800 7:11986913-11986935 CAGAGTAGAAGGACTGAAAGGGG - Intergenic
1022143237 7:27511896-27511918 GATAGTAGGGGGAAGGAAAGAGG - Intergenic
1022289419 7:28986589-28986611 AAGAGAACAGGGAAGGAGGGAGG + Intergenic
1022370345 7:29765323-29765345 TACAATGGAGGGAAGGAAGGAGG + Intergenic
1022437341 7:30401867-30401889 AAGAGAAGAGGGAAGGAGAGAGG - Intronic
1022536529 7:31102006-31102028 GAGAGGAGAAGGAAGGAAGGAGG - Intronic
1022797187 7:33741636-33741658 CATAGGAGAGGCAAGGAATGGGG - Intergenic
1022892918 7:34719312-34719334 CTCAACAGAGGGAAGGAAGGAGG + Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023457142 7:40352453-40352475 GAGAGTAGAGGGAAGGAGGAGGG - Intronic
1023528432 7:41129430-41129452 CAGGCTACAGGGATGGAAGGTGG - Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023683140 7:42709053-42709075 AAGAAAAGAGGGAAGAAAGGAGG - Intergenic
1023737485 7:43247890-43247912 GAGAGAGGAAGGAAGGAAGGAGG + Intronic
1023820463 7:43977714-43977736 GAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1023909668 7:44544448-44544470 AAGAGTAGTGGGGAGGTAGGGGG + Intergenic
1023913771 7:44573549-44573571 GAGAGCTGAGGGGAGGAAGGAGG - Intronic
1024116171 7:46196056-46196078 AAGAGTGCAGGGAAGGGAGGTGG - Intergenic
1024229100 7:47350453-47350475 CAGTCTAGAGAAAAGGAAGGAGG + Intronic
1024270142 7:47635771-47635793 GAGAGGAGAGGGAAGCAGGGGGG + Intergenic
1024355654 7:48411279-48411301 AAGAAAAGAAGGAAGGAAGGAGG - Intronic
1024471090 7:49769463-49769485 AAGGGAAGAAGGAAGGAAGGAGG - Intergenic
1024525293 7:50343260-50343282 AAGAGAGGAAGGAAGGAAGGAGG - Intronic
1024568524 7:50704925-50704947 CAGAGTGGTGGGAAGGAGTGTGG - Intronic
1024877034 7:54037570-54037592 TAGAGCTGTGGGAAGGAAGGAGG - Intergenic
1025099511 7:56123270-56123292 CAGAGGAGAGGCAGGGCAGGAGG + Intergenic
1025258903 7:57404206-57404228 CAGCGCAGAGGGAAGGAGCGGGG + Intergenic
1026066262 7:67076109-67076131 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1026228476 7:68462986-68463008 AAGAGGAGAGAGAAGGAAAGAGG - Intergenic
1026307567 7:69154966-69154988 CAGAGGAGAGGGAAGGGGAGAGG - Intergenic
1026877983 7:73890622-73890644 GAGAGGAGACGGGAGGAAGGAGG - Intergenic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027249393 7:76389627-76389649 CCAAGAAGAGGGAAGGCAGGAGG - Exonic
1027367491 7:77473570-77473592 CAGAGAAGAGGGAAGGAATTAGG + Intergenic
1027603895 7:80275335-80275357 CAGATTAGGGGGAAACAAGGAGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1028382161 7:90211828-90211850 CAGGGGAGAAGGAAGGAGGGAGG - Exonic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028618829 7:92801618-92801640 GAGGGAAGAAGGAAGGAAGGAGG - Intronic
1028751844 7:94391782-94391804 GAGAGTAGAGGGATGGAAGAAGG - Intergenic
1028828977 7:95305944-95305966 GGGAGGAGAGGGAAGGAAGGTGG + Intronic
1028962930 7:96769911-96769933 CAGAGTAGAGAGAGGTGAGGAGG - Intergenic
1029135397 7:98366884-98366906 AAGAGAAGAAGGAAGAAAGGAGG - Intronic
1029145015 7:98439649-98439671 CTCAGTGGAGGGAAGGAAGTGGG - Intergenic
1029204890 7:98863668-98863690 CAGGGAAGGAGGAAGGAAGGAGG - Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029493618 7:100885416-100885438 GAGGGTAGAGGGAAGGCAGTGGG + Intronic
1029729959 7:102433025-102433047 CAGTGGAGGGGAAAGGAAGGTGG - Intergenic
1029748730 7:102531157-102531179 GAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1029748739 7:102531193-102531215 GAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1029766677 7:102630241-102630263 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1029766686 7:102630277-102630299 GAGAGGGGAAGGAAGGAAGGAGG - Intronic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1030114823 7:106055118-106055140 CACAGGAGAGGAAAGGAAGTTGG - Intergenic
1030128291 7:106176154-106176176 GAGAACAGAGGGAGGGAAGGGGG - Intergenic
1030162008 7:106518592-106518614 GAGAGGAGAGGGAAGGAGAGGGG - Intergenic
1030207817 7:106967711-106967733 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1030364751 7:108632636-108632658 AAGAGTAGAGGGAAGTTAGTTGG + Intergenic
1030601712 7:111600758-111600780 TACAGTAGAGGCTAGGAAGGTGG + Intergenic
1030699567 7:112622904-112622926 GAGGGAAGAGGGGAGGAAGGAGG + Intergenic
1031109296 7:117586705-117586727 TTTAGTAGAGGGGAGGAAGGAGG + Intronic
1031171857 7:118302102-118302124 CAGAGATGAGAGAATGAAGGTGG + Intergenic
1031321825 7:120339756-120339778 CAGAGCAGAGGGAAGGGAAGGGG + Intronic
1031326437 7:120404805-120404827 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031663103 7:124451863-124451885 TACAGTAGAGGGAGGGAGGGAGG + Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032078167 7:128845899-128845921 GAGAGGAGAGGGAAAGGAGGGGG + Intronic
1032252749 7:130272007-130272029 AAGAGTCGAGGGATGGAAAGGGG + Intronic
1032275830 7:130454439-130454461 GAAAGTAGAGAGAAGGAAGATGG + Intergenic
1032478091 7:132225962-132225984 CAGAGGAGAGGGAGTGAGGGAGG + Intronic
1032478107 7:132226025-132226047 CAGAGGAGAGGGAGTGAAGGAGG + Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032746765 7:134793918-134793940 TAGAGTAAAGTGAAGGAATGAGG - Intronic
1032937685 7:136752286-136752308 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1033124792 7:138698151-138698173 AAGAATGGAGGGAAAGAAGGAGG + Intronic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1034073904 7:148213745-148213767 CAGAGGACAGGGGAGGGAGGAGG - Intronic
1034427354 7:151021117-151021139 CAGAGGAGAGGGGAAGAAGTGGG - Intronic
1034442372 7:151092486-151092508 CAGAGTTGAGGTAGGGAAGGGGG + Intronic
1034937556 7:155209838-155209860 CAGGGTAGGGGGAAGGGAGCGGG - Intergenic
1035221601 7:157409714-157409736 CAGAGCAGAGGGAGGGAAGCTGG - Intronic
1035943422 8:3930492-3930514 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1037045695 8:14300288-14300310 AAGAATAAAGGGAGGGAAGGAGG + Intronic
1037097982 8:15008619-15008641 CGGATGGGAGGGAAGGAAGGAGG + Intronic
1037293088 8:17372015-17372037 CAGAGGAGGGGGAGGGAATGAGG - Intronic
1037467265 8:19172650-19172672 GAGAGGAGAGGGAGGGGAGGGGG + Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037774376 8:21823273-21823295 GAAAGAAGAGAGAAGGAAGGAGG - Intergenic
1037781045 8:21869300-21869322 AAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1037886569 8:22599169-22599191 CAGAGGAGAGGGAGGGGAGAGGG - Intronic
1037908208 8:22727864-22727886 CTGAGTGGAGGGGAGGAGGGAGG - Intronic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1038691975 8:29772506-29772528 CTCAGCAGAGGGAAGGGAGGAGG + Intergenic
1039226118 8:35390123-35390145 CAGAGGAGAAGCAAGGAAGGAGG + Intronic
1039578307 8:38643476-38643498 AAAAGAAGAAGGAAGGAAGGAGG + Intergenic
1039616233 8:38956967-38956989 CACCTTAGAGGGAAGGAGGGAGG + Intronic
1039954526 8:42196852-42196874 ATGAGAAGAAGGAAGGAAGGGGG + Intronic
1039961757 8:42253902-42253924 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1040547340 8:48409002-48409024 GAGAGAAGAGGAAAGGAAGCTGG - Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041528041 8:58830653-58830675 CAGAAAAGAAGGAAGGAAGAAGG - Intronic
1041673077 8:60512298-60512320 AGGAGGAGAGGAAAGGAAGGGGG + Intergenic
1042300626 8:67276611-67276633 CAAAATATAGGGTAGGAAGGAGG + Intronic
1042397782 8:68311756-68311778 AAGGAAAGAGGGAAGGAAGGAGG - Intronic
1042408862 8:68438901-68438923 AAGAGCAGAAGGAAGGAAGAAGG + Intronic
1042553692 8:70016290-70016312 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1042585520 8:70333903-70333925 AATAGTGGAAGGAAGGAAGGAGG - Intronic
1042732611 8:71954110-71954132 AAGGAGAGAGGGAAGGAAGGAGG - Intronic
1043653513 8:82631264-82631286 CAGAGTAGGGCGGAGAAAGGAGG - Intergenic
1043835118 8:85036793-85036815 GAGAGGAGAGGAAAGGAGGGAGG + Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044338296 8:91015832-91015854 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1044582678 8:93837868-93837890 AAGGAGAGAGGGAAGGAAGGAGG - Intergenic
1044598341 8:93979909-93979931 CCAAGTAGAGGTATGGAAGGTGG - Intergenic
1044623493 8:94213835-94213857 CAGAGTATTGGCAAGGAAGCCGG - Intronic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1044905152 8:96992735-96992757 CAGAGTGGAAGGAAAGAAAGTGG - Intronic
1045112174 8:98946629-98946651 CAGAGAAAAGGGAAAGAAGATGG + Intronic
1045249702 8:100473254-100473276 CAGAGCAGTGGGAAGGGAGGAGG + Intergenic
1045320706 8:101079937-101079959 AAGGAAAGAGGGAAGGAAGGAGG - Intergenic
1045341083 8:101255054-101255076 CAGAAGAGTGGGAAGGAAAGAGG - Intergenic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1045593122 8:103621397-103621419 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1045907937 8:107370742-107370764 AAGAAAAGAAGGAAGGAAGGAGG + Intronic
1045949991 8:107840719-107840741 CATAGTGGAGGGAGGGAAGGGGG - Intergenic
1046605335 8:116365492-116365514 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1046605344 8:116365519-116365541 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1046754258 8:117956832-117956854 AAGAGGAGAGAGAAAGAAGGAGG + Intronic
1047170039 8:122483885-122483907 CAGAGTAGATGGGTGGAAAGTGG - Intergenic
1047324048 8:123819439-123819461 GAAAGAGGAGGGAAGGAAGGTGG - Intergenic
1047665952 8:127091328-127091350 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1047802970 8:128329485-128329507 TGGAGGAGAGGGATGGAAGGGGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048313445 8:133344262-133344284 AAGGGGAGAGAGAAGGAAGGAGG - Intergenic
1048417704 8:134244809-134244831 AAGAGAGGAGGGAGGGAAGGGGG - Intergenic
1048507228 8:135032565-135032587 GAGGGTAGAGGGTGGGAAGGGGG - Intergenic
1048736993 8:137513054-137513076 GAGAAAGGAGGGAAGGAAGGAGG - Intergenic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1048762534 8:137811538-137811560 CAGAGTACAGGAAAGGAAACAGG - Intergenic
1048853061 8:138662749-138662771 CAAAGTAGAGGCAAGACAGGTGG - Intronic
1048979667 8:139696626-139696648 CACAGAGGAGGGAGGGAAGGAGG + Intronic
1049268716 8:141683011-141683033 GCGAGAAGAGGGAGGGAAGGAGG - Intergenic
1049370289 8:142261121-142261143 GAGAGAGGAGGGAGGGAAGGAGG + Intronic
1049372940 8:142276327-142276349 AGGAGGAGAGGGAAGGAAGATGG + Intronic
1049589620 8:143451177-143451199 CAGAGCAGAAGGCAGGAAGCAGG + Intronic
1049819070 8:144623296-144623318 CAGAGTACAAGGAAAGATGGTGG + Intergenic
1049888067 9:41578-41600 GGCAGAAGAGGGAAGGAAGGGGG - Intergenic
1050117482 9:2277123-2277145 CAGGTGAGAGGGAAGGGAGGAGG - Intergenic
1050139795 9:2505594-2505616 CCTAGTAGAGGGAGGGCAGGAGG + Intergenic
1050242318 9:3649907-3649929 CAGAGTACAGGAAAGGAAGATGG + Intergenic
1050255093 9:3785904-3785926 AGGAGGGGAGGGAAGGAAGGAGG - Intergenic
1050299554 9:4243241-4243263 CAGAGTACAGTACAGGAAGGAGG + Intronic
1050423910 9:5494403-5494425 CAAAGTAGAGGGAAAGACTGAGG + Intergenic
1050744320 9:8858389-8858411 CAGAGTCGAGGGCCGGGAGGTGG + Intronic
1050755091 9:8992388-8992410 CAGACTGGAGGCAAGGAATGGGG + Intronic
1050886141 9:10768755-10768777 CAGAGTAGGGGGCAGGGAGATGG - Intergenic
1051048050 9:12899137-12899159 AGGAGAAGAGGGAAGGAAAGAGG - Intergenic
1051374912 9:16392966-16392988 CACAGGAGCGGGAGGGAAGGAGG + Intergenic
1051845821 9:21450013-21450035 CAGAATATTGGGAAGGATGGGGG + Intergenic
1052300343 9:26946776-26946798 GAGAGCAGAGGGAAGGCTGGGGG + Intronic
1052417223 9:28191564-28191586 CAAAGAAGATGGAAGAAAGGGGG - Intronic
1053202223 9:36160515-36160537 AAGAGAAGAGGAAGGGAAGGAGG + Intronic
1053228026 9:36378765-36378787 AAAAGTAGAGGTAAGGAAAGTGG + Intronic
1053357978 9:37462962-37462984 CAGAGAAGAGGGCATGCAGGGGG - Intronic
1053728288 9:41026414-41026436 AAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1055001232 9:71451157-71451179 AAAATGAGAGGGAAGGAAGGAGG - Intergenic
1055018531 9:71644991-71645013 CAGCATGGAGGGAAGTAAGGGGG - Intergenic
1055285574 9:74724928-74724950 AACAGCATAGGGAAGGAAGGGGG - Intronic
1055353219 9:75411169-75411191 CCGAGTGGTGGAAAGGAAGGAGG + Intergenic
1055381323 9:75710098-75710120 GAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1055556111 9:77475614-77475636 TAGAGGAGAGGGGAGCAAGGAGG - Intronic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1056110080 9:83386402-83386424 TAGAGTAAAGGAAAGGATGGGGG - Intronic
1056182849 9:84102389-84102411 CAGTGAGGAGGGAAAGAAGGAGG + Intergenic
1056373140 9:85979340-85979362 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1056838300 9:89976018-89976040 CAGAGAACAGGGTGGGAAGGAGG + Intergenic
1056844194 9:90023444-90023466 CAGAGGTGAGGGAAGAAAGGAGG + Intergenic
1056869761 9:90266429-90266451 AAGAAAAGAAGGAAGGAAGGAGG - Intergenic
1056897751 9:90566691-90566713 AAGAGGTGAGGGAAGGCAGGAGG - Intergenic
1056957231 9:91092037-91092059 GAGAGGAGAGGGAAAGTAGGGGG + Intergenic
1056965168 9:91159369-91159391 AAGAGAGGAGGGAAGGAGGGAGG + Intergenic
1057011058 9:91601628-91601650 GAGAGAGGAAGGAAGGAAGGAGG - Intronic
1057077632 9:92147259-92147281 CAGGGGAGAGGGCAGGAAGGAGG - Intergenic
1057134915 9:92680696-92680718 CTAGGCAGAGGGAAGGAAGGGGG + Intergenic
1057713367 9:97467347-97467369 CAAAGTAGAAGGAGGGAGGGAGG - Intronic
1058163520 9:101595104-101595126 GAGAGAGGAGGGAAAGAAGGAGG + Intronic
1058393881 9:104526964-104526986 CAGTGTTGAGGGAATGGAGGAGG + Exonic
1059166960 9:112086428-112086450 TAGAAAAGAGGGAAGCAAGGTGG + Intronic
1059171654 9:112130468-112130490 CAGAGGAGAGGGAAAGGAGAGGG + Intronic
1059200785 9:112413988-112414010 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1059354231 9:113687085-113687107 CAGAGAAGAGGAAAGGAGGGAGG + Intergenic
1059354401 9:113687815-113687837 CACCGTGGAGGGAAGGAAGGGGG - Intergenic
1059452392 9:114378571-114378593 AGGAAGAGAGGGAAGGAAGGAGG + Intronic
1059562864 9:115352032-115352054 AAGAAGGGAGGGAAGGAAGGAGG + Intronic
1059625661 9:116062248-116062270 AATTGTGGAGGGAAGGAAGGAGG - Intergenic
1059631337 9:116126227-116126249 GATAGAGGAGGGAAGGAAGGGGG - Intergenic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059735299 9:117094207-117094229 GAGAGGAGAGGAAAGGAAAGAGG + Intronic
1059761690 9:117343946-117343968 GAGAGAAGAAGGAAGGAGGGGGG + Intronic
1059818437 9:117944874-117944896 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1060031597 9:120219035-120219057 CTGATGAGAGGGAAGGAAGCAGG + Intergenic
1060135816 9:121152531-121152553 CAAAGAAGCGGGAAGAAAGGTGG + Exonic
1060830899 9:126715585-126715607 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1061157905 9:128876090-128876112 AAGAGTAAAGGGAGGGAAGGTGG - Intronic
1061256370 9:129455985-129456007 GGGAGGAGAGGGAAGGGAGGGGG - Intergenic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061470079 9:130817445-130817467 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1061884324 9:133583998-133584020 TAGAGCAGAGGGGAGGCAGGAGG - Intronic
1061950128 9:133931475-133931497 CAGAAGGGAGGGAAGAAAGGAGG - Intronic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062017907 9:134301002-134301024 AAGAGTGGAAGGAAGGAAGAAGG + Intergenic
1062050488 9:134444360-134444382 GGGGGGAGAGGGAAGGAAGGAGG - Intergenic
1062050604 9:134444634-134444656 AAGAGAAGAGGGAAGGAAGGAGG - Intergenic
1062050612 9:134444671-134444693 TAGGGAGGAGGGAAGGAAGGAGG - Intergenic
1062050628 9:134444718-134444740 AGGAGAAGGGGGAAGGAAGGAGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062144068 9:134979123-134979145 GAGGGGGGAGGGAAGGAAGGAGG + Intergenic
1062277762 9:135738820-135738842 CAGGGGAGTGAGAAGGAAGGAGG - Intronic
1062449088 9:136608106-136608128 AAGAAGAGAGGGAAGGAGGGAGG + Intergenic
1062698293 9:137886410-137886432 CTGAGCAGAGGGCAGGATGGTGG - Intronic
1062722450 9:138051472-138051494 AAGGGGAGAGGGAGGGAAGGAGG - Intronic
1062746268 9:138214381-138214403 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1202802077 9_KI270720v1_random:9437-9459 AAGGAGAGAGGGAAGGAAGGGGG - Intergenic
1203367391 Un_KI270442v1:270757-270779 CAGAATAGTGGGGAGGGAGGCGG - Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185703783 X:2251450-2251472 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1185734303 X:2485630-2485652 GGGAGGAGAGGGAAGGAGGGAGG + Intronic
1185820211 X:3195879-3195901 GAGAGTTAAAGGAAGGAAGGAGG + Intergenic
1186181741 X:6980178-6980200 AAGAGAAGAAGGAAGGAAGAAGG - Intergenic
1186202004 X:7164429-7164451 AAGAGTACAGAAAAGGAAGGAGG - Intergenic
1186367553 X:8911182-8911204 GAGAAAAGAAGGAAGGAAGGAGG + Intergenic
1186490783 X:9970477-9970499 AAGAAGAGAAGGAAGGAAGGAGG - Intergenic
1186578734 X:10793989-10794011 CAGAGAAGTGGCAGGGAAGGAGG - Intronic
1186672348 X:11780550-11780572 CAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187042057 X:15607163-15607185 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1187215012 X:17267662-17267684 TAGAGGAGTGGGAAGGAGGGGGG + Intergenic
1187250547 X:17594300-17594322 CAGTGTAGAAGTGAGGAAGGGGG + Intronic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1187385487 X:18844662-18844684 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1187399743 X:18948995-18949017 CCGAAAAGAGGGAAGGAAGGAGG + Intronic
1187408888 X:19029840-19029862 CAGAGAGGAGGGAGAGAAGGAGG + Intronic
1187704261 X:21993853-21993875 GAAAGGAGAGGGAAGGAAGGAGG - Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187972529 X:24673447-24673469 CAGTTTAGAGGGAAGGCAGCTGG + Intergenic
1188157460 X:26757123-26757145 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1188688428 X:33098897-33098919 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1188749117 X:33884193-33884215 AAGTGCAGAGTGAAGGAAGGGGG - Intergenic
1189097802 X:38158570-38158592 CAGGGAAGAGGGCAGGAAAGAGG - Intronic
1189197146 X:39162252-39162274 GAGAGAAGAAGGAAGGAAGGTGG - Intergenic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1189416916 X:40823420-40823442 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1189593353 X:42538836-42538858 CAGAGTGTAGGGAAGAAATGGGG - Intergenic
1189620647 X:42833833-42833855 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1189823304 X:44891828-44891850 CAGAGGAGAACAAAGGAAGGAGG + Intronic
1189964647 X:46360044-46360066 CAGAGGAGAACAAAGGAAGGAGG + Intergenic
1190280099 X:48923681-48923703 CAGGGTAGAGGGACACAAGGGGG + Exonic
1190534620 X:51413537-51413559 AAGAGAAGAGGGAAAGATGGAGG - Intergenic
1190739471 X:53279892-53279914 GAGAGAGGAAGGAAGGAAGGAGG + Intronic
1190789502 X:53686158-53686180 CAGAGGAGAGGGAAGGTGAGGGG - Intronic
1190999259 X:55642793-55642815 AAGAAAGGAGGGAAGGAAGGAGG + Intergenic
1191716420 X:64196860-64196882 CAGAACACTGGGAAGGAAGGTGG + Intronic
1192363822 X:70455125-70455147 GAGAGGAGGGGGAAGGAGGGAGG - Intronic
1192491533 X:71579981-71580003 CAGAGTGGCGGGAGGTAAGGGGG + Intronic
1192573958 X:72228039-72228061 CAGAGGAGAACAAAGGAAGGAGG - Intronic
1192596166 X:72410672-72410694 TAGGGTAGTGGCAAGGAAGGTGG - Intronic
1192677619 X:73214889-73214911 CATAGTTGTGGGAGGGAAGGAGG - Intergenic
1192735040 X:73842806-73842828 CAGGGCAGAGGGAAGGGAAGAGG + Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1194678720 X:96825794-96825816 GAGAATAGAGTGAAGGAATGAGG - Intronic
1194875871 X:99187409-99187431 GAGAGGAGAGGGAAGGGAGGAGG - Intergenic
1194875878 X:99187431-99187453 GAGAGGAGAGGGAAGGGAGGAGG - Intergenic
1195299045 X:103509388-103509410 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195299055 X:103509413-103509435 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195299078 X:103509479-103509501 GAGAGGGGAGGGAAGGAAAGGGG - Intronic
1195702141 X:107713666-107713688 GAGAGTAAAGGCAAGGAGGGGGG - Exonic
1196136657 X:112217136-112217158 CTGATTGGAGGGAAGGAAGCTGG + Intergenic
1196143532 X:112291924-112291946 AAGGGAGGAGGGAAGGAAGGGGG - Intergenic
1196519557 X:116657119-116657141 CAGAAAAGAGGGAAGGAATCTGG + Intergenic
1196874222 X:120143334-120143356 CAGAGGAGAACAAAGGAAGGAGG - Intergenic
1196898742 X:120362575-120362597 TAGCCAAGAGGGAAGGAAGGAGG + Intronic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197586633 X:128355943-128355965 CTGAGTCTAGGGAAGGTAGGAGG - Intergenic
1197924776 X:131634739-131634761 CAAAGTGGGGGGAAGGGAGGGGG + Intergenic
1198021430 X:132662237-132662259 AACAGATGAGGGAAGGAAGGAGG + Intronic
1198038725 X:132827515-132827537 AAGAAAAGAGGGAAGGAAAGAGG + Intronic
1198229171 X:134673281-134673303 AAGGGAAGAAGGAAGGAAGGAGG + Intronic
1198616303 X:138462491-138462513 CAGAGCAGAGGGGATCAAGGTGG + Intergenic
1198618584 X:138482863-138482885 CAGAGTAGAGGGAGAGGAGGAGG - Intergenic
1198713969 X:139536302-139536324 GAGAGGAGAGGAGAGGAAGGAGG + Intronic
1199038814 X:143085764-143085786 AAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1199151722 X:144494777-144494799 CAGAGGAGACCAAAGGAAGGAGG + Intergenic
1199312147 X:146332915-146332937 CAGAGGAGAGCAAAGGAAGGAGG + Intergenic
1199332165 X:146575094-146575116 CAGAGGAGACCAAAGGAAGGAGG + Intergenic
1199337257 X:146632763-146632785 GAGAAAAGAAGGAAGGAAGGAGG - Intergenic
1199598871 X:149528704-149528726 GAGAGGAGAGGGAAAGAAAGAGG - Intronic
1199950987 X:152706152-152706174 GAGAGAAGGGGGAAGGGAGGAGG + Intergenic
1199953286 X:152722766-152722788 GAGAGAAGGGGGAAGGGAGGGGG + Intergenic
1199956396 X:152745684-152745706 GAGAGAAGGGGGAAGGGAGGGGG - Intergenic
1199958695 X:152762309-152762331 GAGAGAAGGGGGAAGGGAGGAGG - Intergenic
1200683159 Y:6236427-6236449 AAGAGTAGATGGAAGGAGAGAGG + Intergenic
1200832303 Y:7699109-7699131 AAGAATAGAGGGAAGGAGAGGGG - Intergenic
1200960925 Y:8995078-8995100 AAGAATAGAGGGAAGGAGAGGGG + Intergenic
1201049473 Y:9917959-9917981 AAGAGTAGATGGAAGGAGAGAGG - Intergenic
1201122892 Y:10886753-10886775 CAGAGGAGTGGAAAGGAATGGGG - Intergenic
1201187150 Y:11415749-11415771 GAGGGGAGGGGGAAGGAAGGAGG - Intergenic
1201256350 Y:12112007-12112029 GAGAAGAGAGGGAGGGAAGGGGG - Intergenic
1201451171 Y:14116269-14116291 GAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1201470005 Y:14322715-14322737 GAAAGAAGATGGAAGGAAGGAGG - Intergenic
1201550250 Y:15211126-15211148 GAGAGAAGAAGGAAGGAAGAGGG + Intergenic
1201550361 Y:15211713-15211735 GAGAGGGGAAGGAAGGAAGGAGG + Intergenic
1202163644 Y:21963249-21963271 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202227712 Y:22623116-22623138 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202315445 Y:23573062-23573084 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202555356 Y:26097535-26097557 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic