ID: 999092658

View in Genome Browser
Species Human (GRCh38)
Location 5:148951086-148951108
Sequence AGGCCCTTCCACAAGACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999092658_999092660 -5 Left 999092658 5:148951086-148951108 CCTTCAGTCTTGTGGAAGGGCCT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 999092660 5:148951104-148951126 GGCCTTATCTAATCAGCTAAGGG No data
999092658_999092665 18 Left 999092658 5:148951086-148951108 CCTTCAGTCTTGTGGAAGGGCCT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 999092665 5:148951127-148951149 CCTTCAGAGGAAAAAGGATGAGG 0: 1
1: 0
2: 0
3: 38
4: 373
999092658_999092666 28 Left 999092658 5:148951086-148951108 CCTTCAGTCTTGTGGAAGGGCCT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 999092666 5:148951137-148951159 AAAAAGGATGAGGTCTCCCAAGG 0: 1
1: 0
2: 3
3: 25
4: 245
999092658_999092659 -6 Left 999092658 5:148951086-148951108 CCTTCAGTCTTGTGGAAGGGCCT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 999092659 5:148951103-148951125 GGGCCTTATCTAATCAGCTAAGG 0: 1
1: 0
2: 1
3: 12
4: 149
999092658_999092662 5 Left 999092658 5:148951086-148951108 CCTTCAGTCTTGTGGAAGGGCCT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 999092662 5:148951114-148951136 AATCAGCTAAGGGCCTTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 119
999092658_999092663 12 Left 999092658 5:148951086-148951108 CCTTCAGTCTTGTGGAAGGGCCT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 999092663 5:148951121-148951143 TAAGGGCCTTCAGAGGAAAAAGG 0: 1
1: 0
2: 0
3: 27
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999092658 Original CRISPR AGGCCCTTCCACAAGACTGA AGG (reversed) Intronic
900205826 1:1431508-1431530 AGCCCCTTCCCCCAGCCTGAGGG + Intergenic
902149535 1:14431796-14431818 AGGCCTTTGCAACAGACTGAAGG + Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909367372 1:74843490-74843512 TGGCCCTTCTGCAGGACTGATGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
916881300 1:169021924-169021946 AGGGCATTCCAGAAGATTGAAGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923728396 1:236527411-236527433 AGCCCATGCCACAAGACTGAAGG - Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1067683774 10:48455600-48455622 AGCCCCTTCCACAGGCCTGGTGG + Intronic
1070015503 10:72525840-72525862 AGGCTCTCCCACATAACTGATGG - Intronic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1072341408 10:94455429-94455451 AATCTCTTCCACAAGACAGATGG - Intronic
1072403199 10:95126368-95126390 AGGCCCTATGAAAAGACTGAGGG + Intergenic
1074732340 10:116392517-116392539 AGGGCCTTACCCAAGACCGATGG + Intergenic
1075846999 10:125552732-125552754 AGGGAATTACACAAGACTGAGGG - Intergenic
1077257852 11:1596878-1596900 AGGGCCTTGCACAAGACCCATGG - Intergenic
1079889076 11:26028079-26028101 TTGCTCTGCCACAAGACTGAGGG + Intergenic
1081661626 11:44892054-44892076 AGCCCCTTCCCCAAGGCTGTGGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083169882 11:60917106-60917128 AAGCCCTTCCAGAAGCCTGGAGG - Intronic
1083664619 11:64267734-64267756 AGGCCCTAACCTAAGACTGAGGG - Intronic
1083859613 11:65412834-65412856 AGGACATTCCAAAAGACTGGGGG - Exonic
1084795964 11:71504262-71504284 GGTCCCTTCCCCAAAACTGAAGG - Intronic
1084876117 11:72135230-72135252 AGGCCCTGCAACAGGACAGAGGG + Intronic
1084880587 11:72168712-72168734 AGGCCCTTCAACAAGTCTCTAGG - Intergenic
1084880984 11:72171709-72171731 AGGCCCTGCAACAGGACAGAGGG + Intergenic
1084967161 11:72750829-72750851 GTGCCATTACACAAGACTGAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086509784 11:87543926-87543948 AGGCCATTCAACAAGACTCTAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1091229684 11:133980212-133980234 AGCCCCATCCACATTACTGAGGG + Intergenic
1091266481 11:134276007-134276029 AGACCCTTCCAGAAGACAGTGGG - Intronic
1094186797 12:27652248-27652270 AGGCATTTCCAAAGGACTGAGGG + Intronic
1097096093 12:56549701-56549723 AGGGCCTGACATAAGACTGATGG - Intronic
1097575668 12:61389687-61389709 AAGCCATTCCACAAGACTCTAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101274870 12:103188541-103188563 AGGCCCTTCTCCAACACTGGAGG - Intergenic
1101750294 12:107577800-107577822 AGGCCCTACCCCAAGACTTATGG + Intronic
1101876838 12:108601565-108601587 AAGCCCTTCAACAGGACAGAGGG - Intergenic
1103931760 12:124454341-124454363 AGAGGCTTCCACAAGGCTGATGG - Intronic
1104043664 12:125146443-125146465 AGCCCCTCCCACAGGAATGAAGG + Intergenic
1107449019 13:40492049-40492071 AGGCCCATCCCCAACACTGGAGG - Intergenic
1110062760 13:71063106-71063128 AAGCCATTCCACAAGACTCTAGG + Intergenic
1110131871 13:72020253-72020275 AGGTCCTGCCACAACCCTGATGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114283940 14:21222202-21222224 GGAACCTTCCACATGACTGATGG + Intronic
1118963357 14:70556240-70556262 GGGGCCTTCAACAAGTCTGAGGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122238471 14:100346095-100346117 AGGCCCAGCCACAAGTCTCAAGG + Intronic
1124199494 15:27666139-27666161 AGGCCCATCCACATTACGGAAGG - Intergenic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130725304 15:86432926-86432948 AGGCCCTGCCAGAACCCTGAGGG - Intronic
1131401029 15:92125903-92125925 AGGCCCTTCCTGAAGACTCCAGG + Intronic
1131418609 15:92283797-92283819 AGGCCCATCCACATTACAGAGGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134557454 16:15177777-15177799 AGGGCCTTCCTCTAGATTGAGGG + Intergenic
1134918023 16:18089456-18089478 AGGGCCTTCCTCTAGATTGAGGG + Intergenic
1142980117 17:3666758-3666780 AGGGCCTTCCCCAAAACTGCAGG - Intronic
1147327392 17:39676045-39676067 TGTCCCTTCCACCAGACTCAAGG + Intronic
1148384972 17:47227934-47227956 GGGCCCTTCCACCACCCTGAGGG + Intergenic
1148480876 17:47958696-47958718 AGGCCCTTTCAATAGACTGCTGG - Intergenic
1148688712 17:49514606-49514628 AGTCCCTTCCACAGGGCTGGGGG - Exonic
1151406462 17:73890278-73890300 AGGCCCTTGCACAGGAGGGATGG - Intergenic
1152318962 17:79597365-79597387 AAGCCCTTCTACAAGTCTGTAGG - Intergenic
1153861988 18:9220894-9220916 GGGCCATTCCATAAGATTGATGG + Intronic
1156962943 18:43055022-43055044 AGCTACTTCCACAAGCCTGAAGG - Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1158552018 18:58444346-58444368 GGGCCCTCCCACAGGGCTGAGGG - Intergenic
1158937788 18:62380764-62380786 TTGCCCTTCCACAAGCCTCACGG + Intronic
1159378259 18:67622180-67622202 CAGCCCATCCACCAGACTGAAGG - Intergenic
1162130180 19:8521580-8521602 CGGCCCTTCCACCAGCCCGAGGG + Exonic
1163326976 19:16610905-16610927 AGGTTCTCCCACAAGAATGAGGG + Intronic
1165263188 19:34638111-34638133 TGACCTTTCCAGAAGACTGAGGG - Intronic
1166948809 19:46413069-46413091 AGTCCCTCCCTCAAGACTAAGGG - Exonic
928098420 2:28420098-28420120 AGGCCCTCACACAGGTCTGATGG + Intergenic
928239323 2:29572811-29572833 AGGCCCCTCCTACAGACTGAAGG - Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
935259065 2:101339027-101339049 AGCCCCTTCCTCAGGGCTGAGGG - Intergenic
935950064 2:108320593-108320615 AATCCCTTCAACATGACTGAGGG + Intergenic
938108713 2:128550314-128550336 AGACCCTTACACGAGACAGAGGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944047343 2:195428303-195428325 AGGCCCATCCATATTACTGAAGG - Intergenic
947281941 2:228464685-228464707 AGGCCCACCCACAATACTGGGGG + Intergenic
948373343 2:237504601-237504623 GGGCCCTTCTGCAAGGCTGAGGG - Intronic
948380478 2:237547082-237547104 TGGCCCTTACTCAGGACTGACGG - Intronic
1169392706 20:5203311-5203333 AGGCCTTTCCCCAGGCCTGAAGG - Intergenic
1171411576 20:24951616-24951638 AGAGCCTTCCTCATGACTGAGGG + Intronic
1175372921 20:58504674-58504696 AGCCCCATCCACAAGACTGAGGG + Intronic
1175899598 20:62354799-62354821 AGGCCCTGTCACAAGCCTGGAGG + Intronic
1178242836 21:30922427-30922449 AGGCCCTGACACAACACTGAGGG + Intergenic
1180882843 22:19218758-19218780 AGGCTCTTCCACAGGGCTGTGGG + Intronic
1183641037 22:39092570-39092592 CGTCGCTTCCACAAGCCTGATGG + Intergenic
1183828216 22:40404829-40404851 AAGCCCTTCCACAGCACTGATGG - Intronic
949623707 3:5845202-5845224 AAGCCATTCCACAAGTCTGTAGG + Intergenic
951045051 3:18028636-18028658 AGCCCCTTCCCAATGACTGATGG + Intronic
951721643 3:25705550-25705572 AGGCAGCTCCACTAGACTGACGG + Intergenic
961383686 3:126512183-126512205 AGGCCCTGCAACAGGACTGTGGG + Intronic
962398326 3:135036573-135036595 AGGACCCTCCACAGGTCTGAAGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
971465072 4:26948712-26948734 AGGCATTTCCAGAATACTGAAGG - Intronic
972259912 4:37397412-37397434 AGGCCCATCCACATGATGGAGGG - Intronic
975062929 4:70025727-70025749 AGGCCATTTTAGAAGACTGATGG - Intergenic
975063007 4:70026720-70026742 AGGCCATTTTAGAAGACTGATGG + Intergenic
975629862 4:76388678-76388700 AGGACCTTGGACAAGACTCAGGG + Intronic
975856696 4:78632447-78632469 TGGCACTTCCACAAGATGGATGG - Intergenic
976622649 4:87144591-87144613 TTGCCCTTCCAACAGACTGAGGG + Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
983529461 4:168794341-168794363 AGGCCCTCCCACTTCACTGAAGG + Intronic
985943325 5:3156196-3156218 AGGGGCTTCCAAAAGACGGAAGG + Intergenic
987158284 5:15113646-15113668 TTGCGCTTGCACAAGACTGAGGG - Intergenic
988150876 5:27378042-27378064 AGGCCCACCCACATTACTGAAGG + Intergenic
989750169 5:44883897-44883919 TGGCGCTGGCACAAGACTGACGG - Intergenic
990481060 5:56211086-56211108 GGGACCTACCACAAGACTTATGG - Intronic
990931961 5:61102005-61102027 AGGCCCTACCTCAAAACTAATGG - Intronic
992369435 5:76127689-76127711 AGGCAGTTCCACTAGCCTGAAGG - Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
995501476 5:112811867-112811889 AGGGTCTCCCACAAGACTTAAGG + Intronic
999092658 5:148951086-148951108 AGGCCCTTCCACAAGACTGAAGG - Intronic
1002023029 5:176377285-176377307 TGACCTTTCCAGAAGACTGAGGG + Exonic
1004785443 6:18963100-18963122 AGGCAGGTGCACAAGACTGATGG + Intergenic
1005347396 6:24904074-24904096 ATGCACTTGCACAAGATTGAAGG + Intronic
1005601979 6:27435855-27435877 AGGCCATACCATATGACTGAAGG - Intergenic
1006055540 6:31381837-31381859 AGGCCCATCCACATTATTGATGG + Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012903722 6:105038922-105038944 AGAACGTTCCACAATACTGATGG + Intronic
1016884976 6:148950694-148950716 AGGCCCTTCCAGACTACTGAGGG + Intronic
1018026239 6:159808586-159808608 AGGCCCTGCCACATGGCTCATGG + Intronic
1022777333 7:33541179-33541201 AGGCAATTCCACATGCCTGAAGG + Intronic
1022914145 7:34929935-34929957 AGGCGCTGGCACAAGACTGGGGG + Exonic
1022957983 7:35398889-35398911 CTGCCCTTCCACAGGACTGGGGG + Intergenic
1023119906 7:36898937-36898959 AGGCCCTCCCAAAGGGCTGAGGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1030762318 7:113366670-113366692 AGGCACTGCCATAGGACTGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034127462 7:148686443-148686465 AGGCTCTTCCAAAGGAGTGATGG - Intergenic
1034375842 7:150643149-150643171 AGGCACTGCTACAAGAGTGATGG + Intergenic
1034729013 7:153367131-153367153 AGGCCCTGCCACAACATTGGAGG + Intergenic
1034937402 7:155209006-155209028 AGGCTCTTTCTCAAGACTGTAGG + Intergenic
1035367398 7:158358024-158358046 TGGCCCTCCCACAAGGCTTAAGG + Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046397415 8:113658223-113658245 AGGAGCTTTGACAAGACTGAAGG - Intergenic
1047509883 8:125507904-125507926 AGGCCTTTGCACAGGGCTGAGGG + Intergenic
1049340947 8:142112363-142112385 AGGCCTTTCCACCTGCCTGAGGG - Intergenic
1050876878 9:10650757-10650779 AGGTCCTTACACAAGTCTCAGGG - Intergenic
1051569091 9:18535370-18535392 AAGCCATTCAACAAGACTGTAGG + Intronic
1053603644 9:39634643-39634665 AGGCCCTTCCACACTATGGAGGG + Intergenic
1054249896 9:62707776-62707798 AGGCCCTTCCACACTATGGAGGG - Intergenic
1054564006 9:66742298-66742320 AGGCCCTTCCACACTATGGAGGG - Intergenic
1058454476 9:105126570-105126592 AGACCCTGACACAGGACTGAGGG + Intergenic
1060482542 9:124025530-124025552 TGGCCCTTCCACAGGAAGGAAGG - Intronic
1061893973 9:133637381-133637403 AGGCCCTTCCACAAGCTGCAGGG + Intronic
1062178315 9:135176547-135176569 AGGCCCATCTGCAAGACTGTTGG + Intergenic
1186480417 X:9892637-9892659 AGTCCCTTCCAGAATACTGGTGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1189667904 X:43377128-43377150 AAAGCCTTCCACAAAACTGATGG - Intergenic
1192206008 X:69096862-69096884 AGGGCCTGCCCCAAGACAGAGGG + Intergenic
1197110442 X:122767369-122767391 AGACCCTGCCAAAAGACTGGTGG + Intergenic
1199547347 X:149019862-149019884 TGGCACTTCCACAAGATGGAAGG + Intergenic