ID: 999093797

View in Genome Browser
Species Human (GRCh38)
Location 5:148959891-148959913
Sequence CAGAATCATTTGATGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999093797_999093799 23 Left 999093797 5:148959891-148959913 CCAGTCTGCATCAAATGATTCTG 0: 1
1: 0
2: 0
3: 12
4: 164
Right 999093799 5:148959937-148959959 ATCCCTGCCTTTCACAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999093797 Original CRISPR CAGAATCATTTGATGCAGAC TGG (reversed) Intronic
902775095 1:18669588-18669610 CCGACTCTTTTGATGCAGAGAGG + Intronic
902829230 1:18999179-18999201 GAGAATCATTTGAACCAGAGAGG + Intergenic
904134957 1:28305088-28305110 CAGGATCACTTGAGGCAGAGAGG - Intergenic
905702499 1:40028701-40028723 CAGAAGCATTTTTTGCAGACTGG - Intergenic
907272511 1:53299165-53299187 CTGAATCATTTGCTCCACACAGG - Intronic
910213814 1:84821510-84821532 CAGATGATTTTGATGCAGACTGG - Intronic
912795083 1:112688510-112688532 CGGAATGATTTGATTCAGAGGGG - Intronic
920710379 1:208288922-208288944 CAGGATGATTTGATACAGAGTGG - Intergenic
922295264 1:224244559-224244581 AAGAATCACTTGAAGCAGAGAGG - Intronic
923284773 1:232482990-232483012 CAGAGTAATTTGATGCATATTGG - Intronic
923623586 1:235596445-235596467 GAGAATCATTTGAACCCGACAGG + Intronic
923963836 1:239113897-239113919 CACAAACAGTGGATGCAGACAGG - Intergenic
1063848322 10:10156904-10156926 CAAAATCAATCTATGCAGACTGG + Intergenic
1065050311 10:21785285-21785307 CAGATACATCTGATGCACACTGG - Intronic
1065812646 10:29456398-29456420 CGGAATCTTGTGATGCAGGCAGG + Intergenic
1065926582 10:30439325-30439347 CAGCTTCATTTAATGCAGAGTGG + Intronic
1067692610 10:48511571-48511593 CAGAAGTTGTTGATGCAGACTGG + Intronic
1068900525 10:62264739-62264761 TAGAATCATCTGAGGCAGAGAGG + Intronic
1071479027 10:86049168-86049190 CAGCATCATGTGATGGTGACAGG - Intronic
1071678682 10:87682659-87682681 CATCTTCATTTGATGCAGATGGG - Intronic
1074010949 10:109479012-109479034 CAGAATCATTTCTTTCAAACTGG - Intergenic
1074289578 10:112128239-112128261 CAAAATAATTTTTTGCAGACAGG + Intergenic
1077820589 11:5735513-5735535 CAGAAACATTTGCTCCAGGCAGG + Intronic
1077901128 11:6489791-6489813 CAGAGTGATTTGCTCCAGACGGG - Intronic
1078209630 11:9259936-9259958 CAGAATCACTTGAACCAGACAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079213170 11:18482119-18482141 CAGTATCATTTGTCGCTGACAGG - Intronic
1079863663 11:25707376-25707398 ATTAATCATTGGATGCAGACTGG - Intergenic
1080088984 11:28321196-28321218 CAGAAGCATTTAGTGCATACTGG - Intronic
1085195495 11:74669476-74669498 CAGATTCAATTGGTGAAGACAGG - Intergenic
1087075980 11:94127723-94127745 CAGTAACATTTGAAGCAGGCAGG - Intergenic
1087798555 11:102479799-102479821 AAGGAACATTTGATTCAGACAGG + Intronic
1089437153 11:118479033-118479055 CATAATCATATCATGCAGAGTGG + Intronic
1089582819 11:119492134-119492156 CAGAATCAATTGATGGAGAGAGG + Intergenic
1092622075 12:10283193-10283215 CAGAACCACTTGATGGGGACTGG + Intergenic
1093936666 12:25008910-25008932 GAAAATTTTTTGATGCAGACAGG - Intergenic
1094078274 12:26502902-26502924 CATAATCATTTAGTGAAGACAGG + Intronic
1094079810 12:26521482-26521504 CAGATTCATTATATGCAGTCAGG + Intronic
1096813292 12:54185213-54185235 CAGAATCATTTGAACCTGAAAGG + Intronic
1097282157 12:57851812-57851834 CTGAATCATTCCATACAGACAGG - Intergenic
1097821374 12:64132083-64132105 AAGAATCATTTGAACCAGAGAGG + Intronic
1098799220 12:74932272-74932294 CAGCACCATTTGCTGCAGAGTGG + Intergenic
1099177992 12:79444084-79444106 AAGATTCATCTGATGCAGAATGG + Exonic
1101059292 12:100954357-100954379 GAGAATCATGTGCTGCAGAAGGG - Intronic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1107120930 13:36795346-36795368 GAGAATCATTTGAACCAGGCAGG - Intergenic
1108317987 13:49256696-49256718 CCGATTCATTGGATGCAGAGTGG + Intronic
1109453265 13:62546675-62546697 CAGATACATTTGAAGCAGAGAGG + Intergenic
1111797792 13:92945455-92945477 CTGAATTATTTGATGAAAACAGG + Intergenic
1111997659 13:95180823-95180845 CTGTCTCATTTCATGCAGACAGG + Intronic
1113018697 13:105857528-105857550 CAGAATCAGTTTATCAAGACTGG - Intergenic
1114933584 14:27506416-27506438 CAGACTCATTTGCTGCAGCAGGG + Intergenic
1116763796 14:49046602-49046624 CAGAAGCATTTGATACAGAGTGG - Intergenic
1120109513 14:80537363-80537385 AAGAATGATTTGATGGAGAAGGG + Intronic
1121174172 14:91878142-91878164 CAGTAACATTCCATGCAGACTGG - Intronic
1124550742 15:30679045-30679067 CAAAATGATTTGTTGAAGACAGG + Intronic
1128097195 15:64966239-64966261 TAGAATCATATGCTGCAAACTGG - Intronic
1128803815 15:70515599-70515621 GAGAATGCTTTGATGCAGAAAGG - Intergenic
1129231356 15:74198908-74198930 CAGAATCATGTGGTGGAGAAAGG + Intronic
1129582610 15:76828915-76828937 CTGGATCATTTGATCCAGCCTGG - Intronic
1130967618 15:88708900-88708922 CAGCAGCATTTGCTGCAGCCAGG + Intergenic
1135809750 16:25576451-25576473 CAGAACCAATTTATGAAGACAGG + Intergenic
1136635338 16:31517925-31517947 CATGATCCTTTGAGGCAGACAGG + Intergenic
1136665829 16:31811463-31811485 CATGATCCTTTGAGGCAGACAGG + Intergenic
1137663534 16:50232313-50232335 CAGAATCAACTGTTGAAGACTGG - Intronic
1138991523 16:62395846-62395868 TTGAATCATTTGTTGCAGACTGG - Intergenic
1141352629 16:83312330-83312352 TAGAATCATTGGATGGACACTGG + Intronic
1141548834 16:84790792-84790814 CAGAATCATTTGAACCTGAGAGG - Intergenic
1143638678 17:8182434-8182456 CAGAATCATTTGAACCTGAGAGG + Intergenic
1144491563 17:15716751-15716773 CAGCATCAGTTGATTCATACTGG + Exonic
1144908920 17:18662454-18662476 CAGCATCAGTTGATTCATACTGG - Exonic
1146033732 17:29388822-29388844 CAGAATCATTTGATCCTGGGAGG + Intergenic
1151789160 17:76293006-76293028 CAGCATGATTTGATCCAGTCTGG - Exonic
1153929722 18:9867403-9867425 CAGAATCATTTGATGAGTAAGGG - Intergenic
1155669844 18:28356879-28356901 GAGAATCATTTGAACCCGACAGG - Intergenic
1156794565 18:41027616-41027638 CAGAATCATTTTGTACAGCCAGG + Intergenic
1160066698 18:75582114-75582136 CAGAAAGATTTTATGCAGAAGGG - Intergenic
1164845425 19:31428546-31428568 CATAATTATTTTATGCAGAAGGG - Intergenic
1165047868 19:33120451-33120473 CAGAATCATTTGAACCTGAGAGG + Intronic
1165172009 19:33899981-33900003 AAGTTTCATTTGATCCAGACTGG + Intergenic
1165412737 19:35672215-35672237 CAGAGACATTTGACACAGACTGG - Intronic
1168216187 19:54927662-54927684 CAGAATCATTTGTGGAAGAGTGG - Exonic
932527796 2:72490338-72490360 CAGTAACATTTGAAGCAGGCTGG - Intronic
933045346 2:77528537-77528559 CAGAGTCATTTTATCAAGACAGG + Intronic
934161382 2:89252876-89252898 GAGAATCATTTGAACCAGGCAGG - Intergenic
934205898 2:89929539-89929561 GAGAATCATTTGAACCAGGCAGG + Intergenic
939327513 2:140712663-140712685 CAGAATAAACTGATGCAAACTGG - Intronic
941677280 2:168357200-168357222 CAGAATCATTTGCTGCAGTTTGG - Intergenic
943790982 2:191932156-191932178 CAGATTCAGTTGATCCAGAAAGG - Intergenic
946220572 2:218222468-218222490 CATAATCAATTCATTCAGACAGG - Intronic
947399874 2:229720850-229720872 CAAAAACAATTGATGCAGCCAGG + Intergenic
1170252668 20:14302743-14302765 CAGAATCATTTGAACCTGGCAGG - Intronic
1170339579 20:15308860-15308882 CTGAATCATTTGGGTCAGACTGG + Intronic
1172413341 20:34742762-34742784 CAGAATCAGTTAATGATGACAGG - Exonic
1180658495 22:17445209-17445231 GAGAAGAATTTGATGCAGCCAGG + Intronic
1183480809 22:38064464-38064486 AAAAATCATTTGATGCCGCCGGG + Intronic
1185141916 22:49107327-49107349 CAGGATCATTAGAAGCAGAAAGG - Intergenic
949575861 3:5338733-5338755 GAGAATCACTTGAACCAGACAGG - Intergenic
953730133 3:45440169-45440191 GAGAATCATCTGATGTAGCCTGG + Intronic
954966459 3:54615882-54615904 CAGCATCATTTGATTCTTACAGG + Intronic
955469912 3:59275649-59275671 CAGAATTAATTGCAGCAGACTGG + Intergenic
959813853 3:110652438-110652460 CTGTAACATTTGATGCAGAAGGG + Intergenic
961529323 3:127530641-127530663 GAGAATCATTTGAATCTGACAGG + Intergenic
962816261 3:139003866-139003888 CACAATCATATGATGGATACTGG + Intergenic
963181686 3:142363407-142363429 CAGGATAATTTGATGAAGAAGGG - Intronic
965002539 3:162973578-162973600 CTGAATTATTTGAGGCAGATTGG + Intergenic
965570276 3:170165454-170165476 CAGAATTATATGATGAAGGCTGG + Intronic
967254436 3:187575382-187575404 AAGGAACATATGATGCAGACTGG - Intergenic
969218620 4:5744495-5744517 CAGAATCATTTGAGAGAGTCAGG + Intronic
971500517 4:27313501-27313523 CAGAAAGATCTGATGCAGATTGG + Intergenic
972218390 4:36923257-36923279 CAGTGACATTTGATGCTGACAGG + Intergenic
974104232 4:57450232-57450254 CAGAATCACTTGAACCCGACAGG - Intergenic
975238772 4:72032132-72032154 CAGAACCTGTTGCTGCAGACGGG + Exonic
976716758 4:88130989-88131011 CAGAGTCATTTTATCCACACAGG + Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
979065672 4:116129489-116129511 CAGAATAATTTAATGGAGAGAGG - Intergenic
979687104 4:123522971-123522993 CAGAAACATTTTATGCAGAAAGG + Intergenic
980029397 4:127809261-127809283 CAGGATGATTTGTTGAAGACTGG - Intronic
982347203 4:154373152-154373174 AAGAATAAATTAATGCAGACAGG - Intronic
984311235 4:178062325-178062347 CAGAATGATGTGATTCTGACAGG + Intergenic
984992831 4:185397159-185397181 CTGAAGCATTTGCTGGAGACAGG + Exonic
987145682 5:14989110-14989132 GAGAATCACTTGATGCTGAAAGG + Intergenic
987681537 5:21143075-21143097 CAGCATCATTTAATGGGGACAGG + Intergenic
988413898 5:30921168-30921190 CATAATCATTTGATTCACCCTGG + Intergenic
990354129 5:54949183-54949205 CAGAATCATGTGTTGCAGCCAGG + Intergenic
990788096 5:59445671-59445693 CTGAAGCATTTGATTAAGACTGG - Intronic
992500680 5:77339609-77339631 CTCTATCATTTGTTGCAGACTGG + Intronic
993509413 5:88753483-88753505 CAGAATCACTTGAACCAGATAGG - Intronic
998560698 5:143169134-143169156 CAGAAACATGTGAGGAAGACAGG - Intronic
998893355 5:146770239-146770261 GAGAATCATTTGAACCAGGCAGG + Intronic
999093797 5:148959891-148959913 CAGAATCATTTGATGCAGACTGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
1001274434 5:170340049-170340071 CAGATGCTTTTGATGCAGAATGG - Intergenic
1002075607 5:176706470-176706492 GAGTCTCATTTGAAGCAGACAGG + Intergenic
1002535691 5:179874253-179874275 CAGAGTCATGGGATGCAGGCAGG + Intronic
1006418181 6:33917659-33917681 CAGAATCCTTTGGTGCAGGCAGG - Intergenic
1009977571 6:70689091-70689113 GAGAATCACTTGAAGCAGATTGG - Intronic
1010086761 6:71928752-71928774 CAAATTCAATTGATGCAGCCTGG - Intronic
1012439064 6:99245422-99245444 CAGAGTCATGTGCTGCAGAGTGG - Intergenic
1013509175 6:110829078-110829100 GAGAATCATTTGAACCTGACAGG + Intronic
1014917752 6:127173245-127173267 CAGAATGATTTGAAGCAAAAGGG - Intronic
1015647576 6:135410930-135410952 AAGAATCACTTGAACCAGACAGG - Intronic
1016328410 6:142928942-142928964 AAGAATCATTTGATACAGTTTGG - Intronic
1016334450 6:142989419-142989441 GAGAATCATTTGATCCTGAGAGG - Intergenic
1018990637 6:168671063-168671085 CAGAATCATTTGACACAAAATGG - Intronic
1019879499 7:3845982-3846004 CCCAATTATTTGATGCAGAAGGG + Intronic
1023104686 7:36751923-36751945 GACAATCATTGGATGGAGACTGG + Intergenic
1023128505 7:36978717-36978739 CAATATCATTTGATGTTGACTGG + Intronic
1023343294 7:39245564-39245586 CTGAATGATGTGACGCAGACAGG - Intronic
1023577415 7:41643212-41643234 GTGAATTATTTAATGCAGACAGG - Intergenic
1029186134 7:98740100-98740122 GAGAATCATGTGATGGACACTGG + Intergenic
1030660887 7:112218138-112218160 CAGAATCAATTTATCAAGACAGG - Intronic
1030680564 7:112429641-112429663 GAGAATCTGTTGAAGCAGACGGG - Intronic
1031739483 7:125411618-125411640 GAGAATCATTGCATGGAGACAGG + Intergenic
1036077895 8:5521690-5521712 AAGAATCACATGACGCAGACAGG - Intergenic
1038392052 8:27211077-27211099 CAGAATCTGTGGATGCAGAGGGG - Intergenic
1041396925 8:57401245-57401267 CAGAACCATTTTATCCAGACAGG - Intergenic
1046319722 8:112557216-112557238 CTAAATCACTTGAAGCAGACAGG - Intronic
1047904187 8:129455120-129455142 CATAACCATGTGAGGCAGACAGG - Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1048908288 8:139109715-139109737 CAGAATCTTCTGATGAAGAGTGG - Intergenic
1050587919 9:7132288-7132310 GAGAATCCTTTAATGCAGGCTGG + Intergenic
1052017734 9:23488916-23488938 TATAATCTGTTGATGCAGACAGG - Intergenic
1054950003 9:70839098-70839120 CACAATCATGTGATGCAGCTTGG + Intronic
1055792361 9:79936494-79936516 TAGAATAATTTTATGCTGACGGG + Intergenic
1056566968 9:87782080-87782102 CTGAATCTTTTAATGCAGACAGG - Intergenic
1058162876 9:101589058-101589080 GAGAATCATTTGAACCAGAAAGG - Intronic
1059228367 9:112694138-112694160 CAGGATGATTTGTTGAAGACTGG + Exonic
1059556402 9:115284991-115285013 CAGCATCATTTTAGACAGACTGG - Intronic
1062729127 9:138098833-138098855 CAGAATCATGTGTTGCTCACAGG - Intronic
1185644716 X:1608705-1608727 AAGAGTCATTTGCTGCAGAGAGG - Intergenic
1185724633 X:2409817-2409839 CAGAATCACTTGAATCAGAGAGG - Intronic
1187408568 X:19026160-19026182 CTGAATCATTAGATGTAGCCAGG + Intronic
1188704831 X:33314748-33314770 CAGAGTAATGTGATGTAGACTGG - Intronic
1194816668 X:98449932-98449954 CAGAATAACTTGAAGCAGACTGG + Intergenic
1199265384 X:145821366-145821388 CAGAATCAACTGACGCAGCCGGG + Exonic
1201193565 Y:11470322-11470344 CAGAAGCATTGCATGCAGATAGG + Intergenic