ID: 999096562

View in Genome Browser
Species Human (GRCh38)
Location 5:148983489-148983511
Sequence GGTTTCTTGGGACCTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999096562_999096568 14 Left 999096562 5:148983489-148983511 CCAGGTGGAGGTCCCAAGAAACC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 999096568 5:148983526-148983548 TTTTTACAGTTCTGCATATGTGG No data
999096562_999096569 15 Left 999096562 5:148983489-148983511 CCAGGTGGAGGTCCCAAGAAACC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 999096569 5:148983527-148983549 TTTTACAGTTCTGCATATGTGGG 0: 1
1: 0
2: 2
3: 22
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999096562 Original CRISPR GGTTTCTTGGGACCTCCACC TGG (reversed) Intronic
901002862 1:6157300-6157322 GGCTTCTTGGCCCCTCCAGCAGG - Intronic
901416524 1:9120364-9120386 GGTCTCATGGTACCTACACCAGG - Intronic
901860708 1:12072629-12072651 GGGTTCTTGGGTCCTCCAGGGGG + Intronic
902864437 1:19269094-19269116 GTTGTCTTGGGACCTCCAGGAGG - Intergenic
902866665 1:19284509-19284531 GTTGTCTTGGGACCTCCAGGAGG - Intronic
905940582 1:41860098-41860120 GGATTCTGAAGACCTCCACCAGG + Intronic
906236920 1:44217606-44217628 GGTTCCTTGGGGCCTCCAGTAGG + Intronic
907527788 1:55063787-55063809 AGCTTCCTGGCACCTCCACCTGG - Exonic
911699543 1:100935778-100935800 GGTTTCTTGGGACTTCTCTCAGG + Intronic
915034368 1:152909950-152909972 GCTTTGATGGGACCTCCACTGGG - Exonic
1064263852 10:13808753-13808775 GTTTTCTAGTGACCTCCAGCTGG + Intronic
1066671031 10:37839464-37839486 GGTGTCTTGAGACCACCCCCAGG - Intronic
1067288211 10:44922756-44922778 GGTGTCTGGGGACTTCCACTGGG - Intronic
1067761300 10:49049079-49049101 GGGTTCTGGGGAGCTGCACCTGG + Intronic
1074026769 10:109644089-109644111 GCTTTGTTGAGACCTCCCCCAGG + Intergenic
1074570495 10:114619791-114619813 GTTTTCTTTGGACTTCCAGCTGG + Intronic
1075615870 10:123890836-123890858 GGTCTCTTGGGTCCTCTGCCCGG - Intronic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1079284727 11:19117888-19117910 GGCTTCTTTGGACCTCCGTCTGG - Intronic
1079781344 11:24609846-24609868 GGTTTGCTGTGACCTCCAGCAGG - Intronic
1083625712 11:64071078-64071100 TCTCTGTTGGGACCTCCACCTGG + Intronic
1084274561 11:68044778-68044800 GGTGTCTTTGGGCCCCCACCAGG + Intronic
1086794073 11:91078545-91078567 GGTTTCTGGGCCCCTCCCCCAGG - Intergenic
1088112731 11:106280568-106280590 TGTTTCTTGGGACCACCATCTGG - Intergenic
1089564452 11:119363636-119363658 GACTTCCTCGGACCTCCACCCGG + Intronic
1092362172 12:7846220-7846242 CGTTTCCTTTGACCTCCACCTGG - Intronic
1099310037 12:81007409-81007431 GGTTTCATAGTACCTCCTCCAGG - Intronic
1099842436 12:87982590-87982612 GGTTCCTTGGAACCTCCTCAGGG - Intronic
1100285469 12:93162138-93162160 GCTTTCCTGGGAACTCAACCTGG + Intergenic
1100471680 12:94899356-94899378 GGTTTATTGTGAACTTCACCAGG - Intronic
1101879378 12:108616210-108616232 GCTTTCCTGGAACCTCCACCTGG + Intergenic
1102476609 12:113192713-113192735 GCTTTCTTGGACCCTCCACTTGG - Intergenic
1103702216 12:122853780-122853802 GGCTTCCAGAGACCTCCACCTGG - Intronic
1104224180 12:126815017-126815039 TGCTTCTTGGAACCTGCACCAGG + Intergenic
1105357398 13:19671233-19671255 AGTTTATTGGGACCTGCAACAGG - Exonic
1113218310 13:108069111-108069133 TGTTTCTTGGGACCTCCTCAGGG + Intergenic
1118016575 14:61667146-61667168 GCTTTCTGGGTACCTCCACTTGG + Intergenic
1121474861 14:94189638-94189660 GTTTGCTGGGCACCTCCACCAGG + Intronic
1121947357 14:98136128-98136150 GGTTTCTTGGGCCCCACAGCTGG - Intergenic
1122241779 14:100373344-100373366 GGTCTCTTGGGGTCTCCTCCAGG + Intronic
1130970226 15:88726502-88726524 GGTTTCTAGGGACCTCAGCTGGG + Intergenic
1132543919 16:524443-524465 GGCTTCTGGGCACGTCCACCAGG - Intergenic
1132701393 16:1223618-1223640 GGTTTCTTGGGATCCCCACCAGG - Intronic
1135620161 16:23948949-23948971 GGTTTCATGAGATCTACACCTGG + Intronic
1141100793 16:81196190-81196212 GGGTTCTTGGGGCCCCCAGCTGG - Intergenic
1141267428 16:82509567-82509589 GACTTCTTGGGACCCCAACCTGG - Intergenic
1142166224 16:88590632-88590654 GGCTCGTTGGAACCTCCACCTGG + Intronic
1142238834 16:88935945-88935967 GGTTTCTTGGAGCCCCCACCTGG - Intronic
1144772157 17:17765930-17765952 GGCTTCTTGGGAGCTGCCCCTGG + Intronic
1146031347 17:29368788-29368810 TGTTTCCTGGCACTTCCACCTGG + Intergenic
1150562513 17:66305122-66305144 GGTTTCCTGGGACTTCCAATTGG - Intronic
1155137943 18:23015117-23015139 GGTTGCTTGAGACCAACACCAGG - Intronic
1160050413 18:75428198-75428220 GGTTACTTGGGAGCTACCCCAGG + Intergenic
1161282252 19:3452436-3452458 GGTTACTTGGGGGCTCCAGCCGG - Intronic
1161590430 19:5126947-5126969 GGTTTCTTGCCCCCTCCACAGGG + Intronic
1163692202 19:18744026-18744048 GGATGCGTGGGACCTCCCCCCGG - Intronic
1165749658 19:38252204-38252226 GGTCTCTGGGGAACACCACCCGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
925227743 2:2200358-2200380 GGTTCCTTGGAGCCTCCACAAGG - Intronic
927866281 2:26589801-26589823 GCTTTCTTGGAAGCCCCACCCGG - Intronic
931392883 2:61859865-61859887 GGTCTCTTGATACCACCACCAGG + Intergenic
937466357 2:122136294-122136316 GCCACCTTGGGACCTCCACCAGG - Intergenic
942493246 2:176510892-176510914 GGTTACTTGGTGCTTCCACCAGG - Intergenic
946514635 2:220398265-220398287 AGTCTCTTAGGACCTCCACATGG + Intergenic
948489182 2:238300914-238300936 GATTTCCTGGGACCTCCTCTTGG - Intergenic
1171427935 20:25060087-25060109 GGTCTCTCAGGACCTCCACATGG - Intergenic
1171815556 20:29783238-29783260 TTGTTCTTGGGACGTCCACCTGG + Intergenic
1172452853 20:35040478-35040500 AGTTTCTGGGGTCCTCCAGCCGG + Intronic
1174161567 20:48554608-48554630 GGCTTCCTGGAATCTCCACCAGG - Intergenic
1180965847 22:19787597-19787619 TGCTCCTTGGGACCCCCACCTGG - Exonic
950566337 3:13771960-13771982 GCTGTCTTGGGAGCTCCAGCGGG + Intergenic
952740014 3:36725738-36725760 GTTTGCCTTGGACCTCCACCAGG + Intronic
953767310 3:45753471-45753493 GGTTTGTTGGAACATTCACCTGG - Intergenic
968938573 4:3626205-3626227 GGTTTCTCGGGACCAGCATCAGG - Intergenic
971109989 4:23574066-23574088 GTTTTCTTGGGACCTCAAGAAGG - Intergenic
973972807 4:56230434-56230456 TGTCTCTTGTGTCCTCCACCGGG - Intronic
982217952 4:153098869-153098891 GTTTTCTAGAGACCTGCACCTGG + Intergenic
983351172 4:166590752-166590774 GGTTTCTTGGAACAATCACCAGG - Intergenic
990021709 5:51135720-51135742 GGTTTCATGGAACATCCACTTGG - Intergenic
992336716 5:75777914-75777936 GCGTTCCTGGGAGCTCCACCCGG + Intergenic
997364654 5:133318265-133318287 GGGTTCTTGGGGCCTCCAGTTGG + Intronic
997747954 5:136316097-136316119 GATTTCTTGGCCCCACCACCAGG - Intronic
999096562 5:148983489-148983511 GGTTTCTTGGGACCTCCACCTGG - Intronic
999322336 5:150623486-150623508 GGGATCCTGGGACCCCCACCAGG - Intronic
1001998727 5:176183242-176183264 GGATTCTTGGGACCTGATCCAGG - Intergenic
1002650295 5:180686865-180686887 GGATTCTTGGGACCTGATCCAGG - Intergenic
1004254164 6:14047782-14047804 AGATTCCTGGGACCTCCTCCTGG - Intergenic
1010778746 6:79918353-79918375 GGTTTGTTGGAGCCTACACCTGG - Intronic
1013105736 6:107025443-107025465 GGTTTCCAGGGACCTCATCCGGG + Intergenic
1018377416 6:163226560-163226582 GATTGCCTGGGACCTCCTCCAGG - Intronic
1019219714 6:170463953-170463975 GGCTTCTGGGGACCTCAGCCAGG + Intergenic
1021247482 7:18281462-18281484 GGTTTCCTGAAACCTTCACCAGG - Intronic
1023871704 7:44266743-44266765 GGCCTCTTGGGACCTCCTTCAGG - Intronic
1029581443 7:101439127-101439149 GGTTTGTTTGGACCCACACCAGG + Intronic
1030529675 7:110696921-110696943 TGTTTATTGAGCCCTCCACCTGG - Intronic
1037855175 8:22366795-22366817 GGTTTATTTGGAACTCGACCAGG + Intergenic
1038402302 8:27293942-27293964 GGTTACTTGTGAGCTCCTCCAGG + Intronic
1040432488 8:47357423-47357445 GGTTACTTGAGACATCCACCAGG + Intronic
1045152069 8:99419163-99419185 GATTTCTTGAGAACTCTACCAGG - Intronic
1045351370 8:101343464-101343486 GCTCTCTTGGGACCTCCCCAAGG - Intergenic
1050056326 9:1659533-1659555 GGTGTCTGGGCTCCTCCACCCGG + Intergenic
1054452168 9:65409131-65409153 GGTTTCTCGGGACCAGCATCAGG + Intergenic
1059401865 9:114075794-114075816 GGTTTCATGTCACCTCCTCCAGG - Intronic
1062122645 9:134841952-134841974 GGACTCTTGGGACATCCACCGGG + Intronic
1187213830 X:17255196-17255218 CACTTCATGGGACCTCCACCTGG + Intergenic
1188534168 X:31177702-31177724 GGTTTTTTGGTTCCTCCACCAGG - Intronic
1191823583 X:65339684-65339706 GGTTTCCTGGGACCCCAGCCTGG + Intergenic
1194850530 X:98863640-98863662 GTTTTCTTGGGACCTCAAGAGGG + Intergenic
1199945232 X:152660055-152660077 GGGTTCTTGGGACTTCAGCCTGG - Intergenic