ID: 999100597

View in Genome Browser
Species Human (GRCh38)
Location 5:149022069-149022091
Sequence GATCCCTCATAGAGTGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999100597_999100602 7 Left 999100597 5:149022069-149022091 CCCAACTCACTCTATGAGGGATC 0: 1
1: 0
2: 1
3: 26
4: 267
Right 999100602 5:149022099-149022121 GAAATGACAACCCATGGGCTGGG No data
999100597_999100601 6 Left 999100597 5:149022069-149022091 CCCAACTCACTCTATGAGGGATC 0: 1
1: 0
2: 1
3: 26
4: 267
Right 999100601 5:149022098-149022120 TGAAATGACAACCCATGGGCTGG 0: 1
1: 0
2: 4
3: 72
4: 415
999100597_999100599 1 Left 999100597 5:149022069-149022091 CCCAACTCACTCTATGAGGGATC 0: 1
1: 0
2: 1
3: 26
4: 267
Right 999100599 5:149022093-149022115 AGAAGTGAAATGACAACCCATGG No data
999100597_999100600 2 Left 999100597 5:149022069-149022091 CCCAACTCACTCTATGAGGGATC 0: 1
1: 0
2: 1
3: 26
4: 267
Right 999100600 5:149022094-149022116 GAAGTGAAATGACAACCCATGGG 0: 1
1: 0
2: 4
3: 45
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999100597 Original CRISPR GATCCCTCATAGAGTGAGTT GGG (reversed) Intronic
903584243 1:24397410-24397432 GTTGCCTCATTGAATGAGTTTGG - Intronic
904929422 1:34074531-34074553 GATCCCTAATAGAGTGTGGAAGG - Intronic
904986472 1:34553591-34553613 CTATCCTCATAGAGTGAGTTGGG - Intergenic
905711739 1:40110390-40110412 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
906951459 1:50337405-50337427 GACCCCTAATAGTGTTAGTTAGG - Intergenic
908178078 1:61575882-61575904 CTTGCCTCATAGAATGAGTTAGG + Intergenic
909058154 1:70846609-70846631 CAACCCTCAGAGACTGAGTTGGG - Intergenic
909691595 1:78413297-78413319 CTTGCCTCATAGAATGAGTTGGG - Intronic
909715014 1:78697529-78697551 CTTGCCTCATAGAATGAGTTAGG + Intergenic
910513068 1:88027186-88027208 GTGTCCTCATAGAATGAGTTAGG + Intergenic
910642332 1:89476926-89476948 CTGCCCTCATAGAATGAGTTAGG - Intergenic
912053504 1:105564095-105564117 CTTTCCTCATAGAGTGAGTTTGG - Intergenic
912063155 1:105699399-105699421 GAACTTTCATAGGGTGAGTTAGG - Intergenic
912314195 1:108651812-108651834 GAGCCATCATAGATGGAGTTGGG - Intronic
912613352 1:111071593-111071615 GAGTACTCATAGAATGAGTTAGG + Intergenic
912622395 1:111175994-111176016 TTTCCATCATAAAGTGAGTTAGG - Intronic
914380155 1:147108485-147108507 GATCTCTCAGAGACTGAGCTAGG - Intergenic
917043957 1:170835832-170835854 GATCCATCATAAAATTAGTTAGG - Intergenic
917396249 1:174597222-174597244 CTGCCCTCATAGAATGAGTTTGG + Intronic
917499584 1:175574112-175574134 GATCCCTGACAGAGGAAGTTGGG - Intronic
919215454 1:194547592-194547614 GCAGCCTCATAGAATGAGTTTGG + Intergenic
921687040 1:218101843-218101865 CATCCCCCTTAGAGTGGGTTGGG + Intergenic
922843087 1:228660459-228660481 GTAGCCTCATAGAATGAGTTAGG - Intergenic
1065518540 10:26549330-26549352 TAGGCCTCATAGAATGAGTTTGG + Intronic
1069336987 10:67363962-67363984 GCTGCCTCATAAAATGAGTTTGG - Intronic
1069631453 10:69899561-69899583 GATCCCTCGTAACCTGAGTTTGG + Intronic
1070978454 10:80624663-80624685 GGTCCCACTTAGAGCGAGTTTGG - Intronic
1071317069 10:84412295-84412317 GTGACCTCATAGAATGAGTTAGG + Intronic
1072416900 10:95255272-95255294 GTGGCCTCATAGAATGAGTTTGG - Intronic
1072480707 10:95808427-95808449 TATGCCTCGTAGAATGAGTTAGG + Intronic
1075198523 10:120382034-120382056 GGTCCCTAATAGAGTGTGTCGGG + Intergenic
1075297846 10:121293717-121293739 GTTCCGTCACAGAGTGAGATGGG + Intergenic
1075583964 10:123643855-123643877 GAACCTTCATGGAGGGAGTTTGG - Intergenic
1076085890 10:127631115-127631137 GTTGTCTCATAGAATGAGTTAGG + Intergenic
1076526531 10:131115831-131115853 GAACCCTCACAGGGTTAGTTAGG - Intronic
1080256826 11:30299499-30299521 GTGGCCTCATAGAATGAGTTAGG - Intergenic
1080998106 11:37630072-37630094 GCTGGCTCATAAAGTGAGTTTGG + Intergenic
1082435244 11:52728418-52728440 GATTCTACAGAGAGTGAGTTTGG - Intergenic
1082548787 11:54367821-54367843 GATCCTACAAAAAGTGAGTTTGG - Intergenic
1082553816 11:54534932-54534954 GATCCTACAAAAAGTGAGTTTGG - Intergenic
1082607600 11:55260907-55260929 GATCCCTGTTAAAGTCAGTTAGG - Intergenic
1082954056 11:58850002-58850024 TTTGCCTCATAGAATGAGTTTGG - Intronic
1082971247 11:59023625-59023647 CTTGCCTCATAGAATGAGTTTGG - Intronic
1083111425 11:60412238-60412260 GTGGCCTCATAGAATGAGTTAGG + Intronic
1083509978 11:63200141-63200163 CTGCCCTCATAGAATGAGTTAGG - Intronic
1083698252 11:64456971-64456993 GAGCCCTCAGAGAGTGATGTTGG - Intergenic
1085613389 11:77973932-77973954 GGTAACTCATAGAATGAGTTTGG + Intronic
1086703019 11:89921661-89921683 GATCCCTGTTAAAGTCAGTTAGG + Exonic
1086806760 11:91253464-91253486 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
1086839778 11:91670719-91670741 CTTGTCTCATAGAGTGAGTTAGG - Intergenic
1087306088 11:96490585-96490607 CATCCTTCATAAAATGAGTTAGG - Intronic
1087898599 11:103614978-103615000 GATACCTCATAAAATGAATTAGG - Intergenic
1088336409 11:108709295-108709317 GTGGCCTCATAGAATGAGTTAGG + Intronic
1088943761 11:114488009-114488031 CAGCCTTCATAGAATGAGTTTGG + Intergenic
1088965017 11:114710734-114710756 CTTGCCTCATAGAATGAGTTTGG - Intergenic
1092569421 12:9706857-9706879 CTGCCCTCATAGAATGAGTTAGG + Intergenic
1093239751 12:16655799-16655821 GTGGCCTCATAGAATGAGTTGGG + Intergenic
1093897132 12:24586472-24586494 GACGCCTCATGGAATGAGTTAGG - Intergenic
1094559610 12:31539368-31539390 CAGGCCTCATAGAGTGAGTTTGG - Intronic
1094782373 12:33805902-33805924 GTGGCCTCATAGAATGAGTTAGG + Intergenic
1097538047 12:60898785-60898807 GTGGTCTCATAGAGTGAGTTGGG - Intergenic
1099941096 12:89189459-89189481 GGTGCCTCATAAAATGAGTTTGG - Intergenic
1103111420 12:118282597-118282619 GATAGCTCATAGAATGAATTGGG + Intronic
1105592472 13:21806546-21806568 GTTGCCTCATAAAATGAGTTTGG + Intergenic
1105903877 13:24784349-24784371 TTGGCCTCATAGAGTGAGTTAGG + Intronic
1108003966 13:45929419-45929441 GCTACCACATAGAGTGCGTTGGG - Intergenic
1108158619 13:47614750-47614772 CAAGCCTCATAGAATGAGTTGGG + Intergenic
1108545050 13:51484748-51484770 GCTGCCTCATAAAATGAGTTAGG + Intergenic
1109837649 13:67879454-67879476 GAGCCCTCATAGATAGAATTAGG - Intergenic
1111154534 13:84305624-84305646 CATCCCTCATAAAGTTAGTTTGG - Intergenic
1111232077 13:85356663-85356685 GATACCTCATAAAATGACTTAGG - Intergenic
1111952223 13:94717899-94717921 ACTCCCTCATAGAGGGAGTGGGG - Intergenic
1112175909 13:97023797-97023819 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1112997417 13:105590963-105590985 GATCCCTGATAGAGCAACTTAGG + Intergenic
1113202234 13:107878860-107878882 GTAGCCTCATAGAATGAGTTGGG - Intergenic
1113512576 13:110867840-110867862 GTGCCCTCATGGAGTGAGTGCGG - Intergenic
1114601446 14:23958725-23958747 GAGCCCTCTGAAAGTGAGTTGGG - Intronic
1114665981 14:24377427-24377449 GAGCCCACATGGAGGGAGTTGGG + Exonic
1115861563 14:37692150-37692172 CCTGCCTCATAGAATGAGTTTGG - Intronic
1116197364 14:41745988-41746010 GTGGCCTCATAGAATGAGTTAGG - Intronic
1116648641 14:47562233-47562255 CTGGCCTCATAGAGTGAGTTAGG + Intronic
1117633637 14:57720337-57720359 CTGGCCTCATAGAGTGAGTTTGG + Intronic
1117749554 14:58906358-58906380 CAGTCCTCATAGAATGAGTTTGG - Intergenic
1120724991 14:87928260-87928282 GATACCTCATAAATTCAGTTTGG - Intronic
1125124457 15:36203303-36203325 GATGCCTCATAAAATAAGTTTGG + Intergenic
1125135702 15:36339161-36339183 CAGACCTCATAGAATGAGTTAGG + Intergenic
1126996140 15:54447277-54447299 GATACCTCATAAAATGAGTTAGG + Intronic
1127024224 15:54784968-54784990 CTACCCTCATAGAATGAGTTAGG - Intergenic
1127042694 15:54994416-54994438 GATACCTCATAAAATGAGTTAGG - Intergenic
1130315595 15:82792940-82792962 TATGTCTCATAGAATGAGTTGGG + Intronic
1130619728 15:85449923-85449945 CTGGCCTCATAGAGTGAGTTGGG + Intronic
1131129601 15:89888540-89888562 GATTCCTCAGAGAGTGAACTTGG - Exonic
1131710762 15:95053853-95053875 GTGGCCTCATAGAGTGACTTAGG + Intergenic
1135637091 16:24087067-24087089 GATCCATCTGAGAGTAAGTTGGG + Intronic
1136908197 16:34121967-34121989 GATCTCTCATAAAGTTACTTTGG - Intergenic
1140147247 16:72323375-72323397 GATACTTCATAGAATGAGTTAGG + Intergenic
1141071379 16:80958283-80958305 GTGGCCTCATAGAATGAGTTAGG - Intergenic
1141311897 16:82921752-82921774 GTGGCCTCATAGAATGAGTTGGG + Intronic
1143227457 17:5318699-5318721 CAGACCTCATAGAATGAGTTAGG - Intronic
1143744607 17:8982802-8982824 GTGCCCTCATAAAATGAGTTGGG - Intergenic
1152582694 17:81173790-81173812 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1153726849 18:7965479-7965501 GAACCCTTATTGAGTGAGATTGG + Intronic
1155597657 18:27506803-27506825 CTAGCCTCATAGAGTGAGTTTGG - Intergenic
1156150746 18:34239907-34239929 ATGCCCTCATAGAATGAGTTAGG + Intergenic
1156572375 18:38271696-38271718 CAGCCTTCATAGAATGAGTTTGG + Intergenic
1157509253 18:48257542-48257564 GCTCCCTCATGGAATGGGTTGGG - Intronic
1158754296 18:60303548-60303570 GATGCCTCATAAAATGAGTTAGG - Intergenic
1161774665 19:6253465-6253487 CCGCCCTCATAAAGTGAGTTAGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167556526 19:50199579-50199601 GATCCCTGAGATAATGAGTTTGG + Intronic
925269805 2:2595970-2595992 CTGGCCTCATAGAGTGAGTTTGG - Intergenic
928250892 2:29677792-29677814 GTGGCCTCATAGAATGAGTTGGG + Intronic
928271750 2:29861768-29861790 TTTGCCTCATAAAGTGAGTTTGG - Intronic
928303958 2:30150229-30150251 CATCTGTCATAGGGTGAGTTGGG + Intronic
928494938 2:31822004-31822026 CTTGCCTCATAGAATGAGTTTGG + Intergenic
929540969 2:42820882-42820904 CTTGCCTCATAGAATGAGTTTGG + Intergenic
933444306 2:82358486-82358508 CTACCCTCATAGAATGAGTTAGG + Intergenic
933674868 2:85045943-85045965 TAGCCCTCATAGATAGAGTTGGG + Intronic
934100203 2:88645709-88645731 TAAGCCTCATAGAATGAGTTAGG - Intergenic
934906039 2:98204716-98204738 CTGGCCTCATAGAGTGAGTTGGG + Intronic
935143185 2:100373939-100373961 ATTGCCTCATAGAATGAGTTGGG - Intergenic
935482370 2:103608199-103608221 GATGCCTCTTAAAATGAGTTGGG - Intergenic
936264386 2:110990985-110991007 CATCTCTCATAGAGTTATTTTGG + Intronic
938862523 2:135384480-135384502 GCTGCCTCATAAAATGAGTTAGG - Intronic
939477862 2:142709754-142709776 GCTGCCTCATAAAATGAGTTAGG + Intergenic
939744155 2:145948686-145948708 CTTCCCTCATAAAATGAGTTAGG + Intergenic
941010988 2:160298957-160298979 GATCCCTCATAGCCTGGCTTGGG + Intronic
941179100 2:162236308-162236330 AATACCTTATAGAATGAGTTGGG + Intronic
942971874 2:181966811-181966833 CTTGCCTCATAGAATGAGTTTGG + Intronic
943566136 2:189519233-189519255 GATCCCTCACACAGAGGGTTAGG - Intergenic
944436907 2:199699538-199699560 GCTGCCTCATAGAATGAGTTAGG - Intergenic
945490494 2:210448991-210449013 GATGCCTCATAAAATGAGTTAGG - Intronic
946424761 2:219587958-219587980 GATCCTTCATAGACAGAGTCGGG + Intergenic
1169625233 20:7560024-7560046 CTAGCCTCATAGAGTGAGTTAGG + Intergenic
1170506254 20:17028760-17028782 GATCCCACAGAAAATGAGTTAGG + Intergenic
1170637540 20:18121339-18121361 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1171484115 20:25475393-25475415 AATGCCTCATAGAATGAGTTTGG - Intronic
1171772854 20:29338869-29338891 GATCTCTCATAAAGTTACTTTGG + Intergenic
1173087805 20:39941199-39941221 GATGCTTCAAAGAGTGACTTAGG - Intergenic
1173712192 20:45168659-45168681 GATGCCTAATAGAATGAGTTGGG - Intergenic
1176999434 21:15593738-15593760 CCGGCCTCATAGAGTGAGTTTGG - Intergenic
1177022671 21:15882901-15882923 CTGCCCTCATAGAATGAGTTAGG + Intergenic
1179231175 21:39505135-39505157 AATCCCCCATAGAATGAGGTGGG - Intronic
1180318250 22:11296742-11296764 GATCTCTCATAAAGTTACTTTGG + Intergenic
1182876487 22:33695955-33695977 GATTCCTAATAGATCGAGTTTGG - Intronic
1182986071 22:34718136-34718158 TTTGCCTCATAGAATGAGTTAGG - Intergenic
1184804693 22:46786513-46786535 CTTGCCTCATAGAATGAGTTGGG + Intronic
950293015 3:11802683-11802705 GCGGCCTCATAGAATGAGTTAGG - Intronic
950922767 3:16712058-16712080 CAGGCCTCATAGAATGAGTTAGG + Intergenic
954949374 3:54456614-54456636 TTGGCCTCATAGAGTGAGTTTGG + Intronic
959679604 3:109079105-109079127 GTAGCCTCATAGAATGAGTTGGG - Intronic
960680198 3:120239574-120239596 CTGCCCTCATAGAATGAGTTGGG + Intronic
960771223 3:121194572-121194594 GTGGCCTCATAGAATGAGTTGGG + Intronic
961447972 3:126989945-126989967 CATCCCCCAGAGAGTGGGTTTGG + Intronic
962001390 3:131301860-131301882 CTGGCCTCATAGAGTGAGTTAGG + Intronic
962472802 3:135728189-135728211 CTACCCTCACAGAGTGAGTTAGG + Intergenic
962584268 3:136825905-136825927 CTGGCCTCATAGAGTGAGTTCGG + Intronic
963459404 3:145589227-145589249 GTAGCCTCATATAGTGAGTTTGG - Intergenic
963616074 3:147539713-147539735 CTGGCCTCATAGAGTGAGTTGGG + Intergenic
964513202 3:157476365-157476387 GATCCCTCAAATAGTGAATCAGG - Intronic
964779968 3:160326311-160326333 CAGACCTCATAGAATGAGTTAGG - Intronic
965065043 3:163837534-163837556 TATTCCTCATGGAGTTAGTTTGG - Intergenic
966087098 3:176080934-176080956 GATCCTTCATATATTGAGCTGGG + Intergenic
966958036 3:184904710-184904732 TTTGCCTCATAGAATGAGTTGGG + Intronic
969908845 4:10424607-10424629 AATACCTCATAAAATGAGTTAGG + Intergenic
970821535 4:20221157-20221179 GTGGCCTCATAGAATGAGTTTGG + Intergenic
970874358 4:20852116-20852138 GATGCTTCATAGAATGAATTAGG - Intronic
973708893 4:53606596-53606618 GATACCAAATAGAATGAGTTAGG - Intronic
973732550 4:53836980-53837002 GCTGCCTCATAAAATGAGTTAGG - Intronic
973834913 4:54799821-54799843 GATACCTCATAAAATGAGTTAGG - Intergenic
974161497 4:58147164-58147186 CTTGCCTCATAGAATGAGTTGGG - Intergenic
974275843 4:59720069-59720091 GCTGCCTCATAAATTGAGTTAGG + Intergenic
974680463 4:65154609-65154631 GGTTCCTCATAAAGTGAGATAGG - Intergenic
975301891 4:72799804-72799826 GCTGCCTCATAAAATGAGTTAGG - Intergenic
975467957 4:74731591-74731613 GAGGCCTCATGGAGCGAGTTTGG - Intergenic
975977823 4:80119201-80119223 CTGGCCTCATAGAGTGAGTTGGG - Intronic
976190364 4:82481106-82481128 GGTCACTCAGAGAGTGAGTGTGG + Intergenic
979184793 4:117774325-117774347 CTGGCCTCATAGAGTGAGTTTGG - Intergenic
980090579 4:128438975-128438997 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
980099986 4:128532388-128532410 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
980185228 4:129452701-129452723 GATCCCTGATAGTATTAGTTAGG + Intergenic
980536523 4:134130664-134130686 GATACTTCATAGAATGATTTAGG - Intergenic
980956220 4:139431806-139431828 TTTGCCTCATAGAATGAGTTTGG + Intergenic
986655717 5:10009651-10009673 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
986753871 5:10815590-10815612 CTGCCCTCATAGAATGAGTTAGG - Intergenic
988021879 5:25631157-25631179 GCTGCCTCATAAAATGAGTTAGG - Intergenic
988399301 5:30741323-30741345 GAGGACTCATAGAGTGAGTTCGG - Intergenic
989428152 5:41320246-41320268 CTGGCCTCATAGAGTGAGTTTGG - Intronic
989784371 5:45309870-45309892 CTTCCCTCATAGAATAAGTTAGG + Intronic
990168880 5:53025474-53025496 AATCCCTGATACAGTGATTTTGG + Intronic
990396134 5:55380809-55380831 CAGGCCTCATAGAATGAGTTAGG + Intronic
990828285 5:59927004-59927026 CATACCTCATAGAATGTGTTTGG - Intronic
991318614 5:65341829-65341851 GTGGCCTCATAGAATGAGTTAGG - Intronic
992835102 5:80632504-80632526 GTGACCTCATAGAGTGAGTTAGG - Intronic
993140135 5:84022037-84022059 AATGCCTCATAGAATTAGTTAGG - Intronic
993205786 5:84876646-84876668 CAGGCCTCATAGAATGAGTTTGG - Intergenic
993206752 5:84891421-84891443 CAGGCCTCATAGAATGAGTTTGG + Intergenic
993634038 5:90322734-90322756 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
995428906 5:112053027-112053049 GTGGCCTCATAGAATGAGTTGGG - Intergenic
995660772 5:114480494-114480516 CTTGCCTCATAGAATGAGTTAGG - Intronic
999100597 5:149022069-149022091 GATCCCTCATAGAGTGAGTTGGG - Intronic
999357380 5:150948053-150948075 TATACCTCATAGAATGAGTTAGG + Intergenic
999958868 5:156732598-156732620 GATGCCTCATAGAATGAGTTAGG + Intronic
1000509942 5:162168246-162168268 CTTCCCTCATAGAATGAGTTAGG - Intergenic
1002870299 6:1161057-1161079 GGTCCCTTATTGACTGAGTTAGG - Intergenic
1002976044 6:2077786-2077808 CTGCCCTCATAGAATGAGTTAGG + Intronic
1003394312 6:5740207-5740229 GTCCCCTCCTAGAGTGGGTTAGG + Intronic
1004574671 6:16883718-16883740 TTGCCCTCATAGAATGAGTTGGG + Intergenic
1004792878 6:19047887-19047909 CTTGCCTCATAGAATGAGTTAGG + Intergenic
1005250481 6:23940551-23940573 GCAGCCTCATAGAATGAGTTGGG - Intergenic
1005718225 6:28573655-28573677 GATCCTTCATATATTGAGTTTGG - Exonic
1007190825 6:40016616-40016638 CTGCCCTCATAGAATGAGTTAGG + Intergenic
1008820168 6:55622764-55622786 TTTGCCTCACAGAGTGAGTTTGG + Intergenic
1009266175 6:61557639-61557661 GTAGCCTCATAGAGTGAGTTTGG + Intergenic
1009447179 6:63756630-63756652 CTGCCCTCATAAAGTGAGTTAGG + Intronic
1010174374 6:73010010-73010032 AATGCCTCATAGAATTAGTTAGG - Intronic
1010674926 6:78731777-78731799 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1011320279 6:86084111-86084133 GCTGCCTCATAGAATGAGTTAGG + Intergenic
1011369770 6:86623435-86623457 TTGACCTCATAGAGTGAGTTTGG + Intergenic
1011916635 6:92513964-92513986 CCTGCCTCATAGAATGAGTTAGG - Intergenic
1012297541 6:97543899-97543921 GTGGCCTCATAGAATGAGTTTGG + Intergenic
1012605650 6:101154751-101154773 GCTGCCTCATAAAATGAGTTAGG + Intergenic
1012755767 6:103228219-103228241 GAGCCCTCATAGAGGCAGTGAGG + Intergenic
1014289056 6:119537627-119537649 CTGCCCTCATAGAATGAGTTGGG + Intergenic
1014520899 6:122440729-122440751 TAGGCCTCATAGAATGAGTTGGG - Intergenic
1014679372 6:124409698-124409720 GCTGCCTCATAAAATGAGTTAGG + Intronic
1015989535 6:138922681-138922703 GACCCCTCATAGAAGGAGCTGGG - Intronic
1016453314 6:144206231-144206253 CTGGCCTCATAGAGTGAGTTGGG + Intergenic
1016755501 6:147680999-147681021 GCTGCCTCATAGAATGAATTTGG + Intronic
1017056090 6:150436534-150436556 CAGCCCTGACAGAGTGAGTTGGG - Intergenic
1020860520 7:13487073-13487095 CAGGCCTCATAGAATGAGTTGGG - Intergenic
1021425945 7:20499498-20499520 TAGGCCTCATAGAATGAGTTAGG - Intergenic
1021431549 7:20564569-20564591 GTAGCCTCATAGAATGAGTTTGG - Intergenic
1022258543 7:28682699-28682721 GATCCTTCCTAGAGAGAGCTGGG - Intronic
1024034045 7:45491968-45491990 GATGCCTCATAAAATGAGTTAGG + Intergenic
1024660878 7:51493185-51493207 CAAGCCTCATAGAATGAGTTTGG + Intergenic
1026508733 7:71009659-71009681 CATCCCTGATAGAGAGAGTGGGG + Intergenic
1027402047 7:77819739-77819761 CAGGCCTCATAGAATGAGTTAGG + Intronic
1027552244 7:79613470-79613492 TTTCCCTCTTAGACTGAGTTTGG + Intergenic
1027895774 7:84042481-84042503 AATCACTCACAGAGTGAGTCAGG + Intronic
1027982255 7:85240495-85240517 GTTACCTCATACAATGAGTTTGG + Intergenic
1028640174 7:93033405-93033427 AATGCCTCATAGAATGAGCTGGG - Intergenic
1029325538 7:99804607-99804629 ACTGCCTCATAGAATGAGTTTGG - Intergenic
1029522915 7:101075603-101075625 GATCCCTCAAGGAGGGAGTGTGG + Intergenic
1030254717 7:107496155-107496177 TGGCCCTCATAGACTGAGTTAGG - Intronic
1031700874 7:124924607-124924629 GATACCTTGTAGAATGAGTTAGG - Intronic
1032459309 7:132097992-132098014 GATCCCTCCTATAGTGAGCACGG + Intergenic
1032965881 7:137096863-137096885 CTGGCCTCATAGAGTGAGTTAGG - Intergenic
1033838189 7:145341356-145341378 GCTGCCTCATAAAATGAGTTAGG - Intergenic
1036189018 8:6652938-6652960 GATGCCTCATAAAATGAGTTAGG - Intergenic
1039002004 8:32991688-32991710 GTGGCCTCATAGAATGAGTTTGG + Intergenic
1040355280 8:46611499-46611521 GTGGCCTCATAGAATGAGTTTGG - Intergenic
1041297963 8:56380076-56380098 CTGCCCTCATAGAGTGAGTTGGG + Intergenic
1042958863 8:74281390-74281412 GATCCCTCAGTGAGCCAGTTTGG + Intronic
1043177370 8:77039267-77039289 GAGCTCTCAAAGAATGAGTTAGG - Intergenic
1043832357 8:85004787-85004809 GATACTTCATAGAGTGATTTAGG - Intergenic
1044673184 8:94703699-94703721 GGTATCTCAGAGAGTGAGTTTGG - Intronic
1044801160 8:95957912-95957934 GAGCCCTCATAGATTGGATTAGG + Intergenic
1045306525 8:100961411-100961433 CATTTCTTATAGAGTGAGTTTGG - Intergenic
1045789805 8:105969878-105969900 CTTGCCTCATAGACTGAGTTGGG + Intergenic
1046073339 8:109285301-109285323 CTGCCTTCATAGAGTGAGTTAGG - Intronic
1048119068 8:131559398-131559420 TTTGCCTCATAGAATGAGTTTGG - Intergenic
1050659227 9:7864651-7864673 CTGGCCTCATAGAGTGAGTTAGG + Intronic
1051110574 9:13630793-13630815 TGGCCCTCATAGAATGAGTTAGG - Intergenic
1055646774 9:78368743-78368765 GATCCCTCAAGAAGTGATTTGGG - Intergenic
1057636021 9:96767866-96767888 GGTAACTCATAGAATGAGTTAGG - Intronic
1058994095 9:110282764-110282786 AATCACTGATAGACTGAGTTTGG - Intergenic
1060367978 9:123038997-123039019 CATACCTCATAGGGTTAGTTTGG + Intronic
1062340158 9:136090567-136090589 GGTCCCTCATGGAGGGCGTTGGG - Intronic
1186964107 X:14769167-14769189 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
1187440756 X:19317380-19317402 AATGCCTCATAAAGTGAGTTTGG + Intergenic
1187743334 X:22380515-22380537 GTACCCTGATAGAATGAGTTAGG + Intergenic
1187956509 X:24523876-24523898 GCTCCCTCATACAGTGAATCCGG + Intronic
1188644676 X:32551119-32551141 CTTCCCTCATAGAATGAGTTAGG - Intronic
1188773788 X:34188381-34188403 AATACCTCATAGAATGAGTCTGG + Intergenic
1191100012 X:56716481-56716503 GTGGCCTCATAGAATGAGTTAGG - Intergenic
1191705427 X:64089262-64089284 GCTGCCTCATAAAATGAGTTAGG - Intergenic
1191815975 X:65245328-65245350 TTTGCCTCATAGAATGAGTTAGG - Intergenic
1193006249 X:76621510-76621532 TTTGCCTCATAGAATGAGTTTGG - Intergenic
1193263897 X:79444662-79444684 TTTACCTCATAGAATGAGTTTGG + Intergenic
1193552905 X:82920981-82921003 CTGGCCTCATAGAGTGAGTTAGG + Intergenic
1193620113 X:83742186-83742208 CAGGCCTCATAGAATGAGTTTGG - Intergenic
1193631520 X:83894214-83894236 GTGGCCTCATAGAATGAGTTTGG + Intergenic
1193703716 X:84794356-84794378 CTTCCCTCTTAGAATGAGTTAGG - Intergenic
1193854532 X:86582850-86582872 CTTCCATCATAGAATGAGTTAGG - Intronic
1194874950 X:99175158-99175180 GTGGCCTCATAGAATGAGTTAGG - Intergenic
1195024195 X:100859441-100859463 CTGGCCTCATAGAGTGAGTTAGG + Intronic
1195125784 X:101808464-101808486 GCTGGCTCATAGAATGAGTTAGG + Intergenic
1196010748 X:110885353-110885375 CTTGCCTCATAGAATGAGTTAGG + Intergenic
1196215309 X:113044095-113044117 CAGGCCTCATAGAATGAGTTTGG + Intergenic
1196312709 X:114187107-114187129 GATGCCTCATAAAATGAGTTAGG - Intergenic
1196967562 X:121075027-121075049 GCTGTCTCATAGAATGAGTTGGG + Intergenic
1197077843 X:122374794-122374816 CTGGCCTCATAGAGTGAGTTTGG + Intergenic
1199196601 X:145038828-145038850 GCTCACTCATAGAATCAGTTGGG - Intergenic
1199216849 X:145269304-145269326 CTGCCCTCATAGAATGAGTTAGG - Intergenic