ID: 999100758

View in Genome Browser
Species Human (GRCh38)
Location 5:149024026-149024048
Sequence CAGTGTTCTCAAAGGGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 5, 3: 18, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999100752_999100758 23 Left 999100752 5:149023980-149024002 CCTTAAGAAAAGATGCACTGTGT 0: 1
1: 0
2: 1
3: 29
4: 218
Right 999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG 0: 1
1: 1
2: 5
3: 18
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999100758 Original CRISPR CAGTGTTCTCAAAGGGCTGT TGG Intronic
900129766 1:1082438-1082460 CACTGTTCTCAGAGGGGTCTCGG + Exonic
900791461 1:4683733-4683755 GAGTGCCCTCAAATGGCTGTGGG - Intronic
901213967 1:7543614-7543636 CATTGTTCTCAAACAGTTGTTGG + Intronic
901901744 1:12370061-12370083 CAGTATTCTCAATGGGATGGTGG - Intronic
902897344 1:19487899-19487921 CTGTGTTCTGAATGGACTGTAGG + Intergenic
904393379 1:30200159-30200181 CAGGGATTTCTAAGGGCTGTTGG - Intergenic
906244096 1:44261097-44261119 TCGAGTTCTCAAAGGACTGTGGG - Intronic
906339926 1:44970628-44970650 CAGTGTTTGCTAAGGGATGTCGG - Intronic
907571679 1:55489769-55489791 CAGTGTTCTTGAAAGGCTGTGGG + Intergenic
907679610 1:56551006-56551028 CAGAGTTCGCAAAGGCCTATGGG - Intronic
908270696 1:62419549-62419571 CAGTGATTTCAAAGGGCTTATGG - Intergenic
908863775 1:68521630-68521652 CAGAGTTCTCAAACAGCTGCTGG + Intergenic
909726517 1:78842531-78842553 CACTGTTCTCAAGGGGCTTATGG + Intergenic
911259781 1:95671871-95671893 CAGTGGTCTCAAATGGATGCTGG - Intergenic
911508122 1:98779200-98779222 CAGGTTTCTCAAAGGACTGTGGG - Intergenic
912551015 1:110485310-110485332 CATCTTCCTCAAAGGGCTGTTGG - Intergenic
914244016 1:145872653-145872675 CAGCGGTCTCCGAGGGCTGTGGG - Exonic
914950463 1:152109535-152109557 CAGTGATCTGAAATGGCAGTGGG - Exonic
915097610 1:153474515-153474537 CTTTGTTTTCAAAGGGCTGCTGG + Intergenic
916070887 1:161169123-161169145 CAGTGTTCTCAGAGGCCAGCCGG + Exonic
917256110 1:173118041-173118063 CTGTGTTCCCAAGGAGCTGTAGG - Intergenic
917804234 1:178598843-178598865 CTGTATTCTCAAAGAGCTGATGG - Intergenic
921287042 1:213618290-213618312 CAGTGTTCTCAAAGGAGTTGTGG - Intergenic
923013342 1:230106412-230106434 CAGTGTGCTGAAACTGCTGTTGG + Intronic
923361101 1:233211869-233211891 CAGTTTTTTCAAAGGACTCTGGG + Intronic
923411797 1:233717882-233717904 CAGGTTTCTCACAAGGCTGTTGG + Intergenic
923516055 1:234698797-234698819 CAGTGTCAGCAAAGTGCTGTGGG - Intergenic
923865804 1:237938330-237938352 CAGTGTTCTCAAAGTGCTGTTGG + Intergenic
1062867340 10:866840-866862 CACTGCTTTCAAAGTGCTGTTGG - Intronic
1067253691 10:44613324-44613346 AAGGGCTTTCAAAGGGCTGTGGG + Intergenic
1067278241 10:44852873-44852895 GAATGTTCTCAAAAGGGTGTGGG - Intergenic
1068262357 10:54599364-54599386 CAGTTTTCTCAAAGAGCAGATGG - Intronic
1069737799 10:70669011-70669033 CAGTGTCCACAGAGGGCTGCTGG + Intergenic
1070528279 10:77313650-77313672 CCCTGTTCTCAAAGAGCTCTTGG - Intronic
1070585222 10:77760374-77760396 CATTGTTCTCAAAGAGCTGTTGG - Intergenic
1071099697 10:82020938-82020960 CAGTGTTCCCAAATCACTGTTGG + Intronic
1072535424 10:96359258-96359280 CATTGTTTCCAAAGGGCTGCAGG - Exonic
1074532865 10:114309006-114309028 CAGTCTGCTCACAGGGGTGTTGG + Intronic
1075247854 10:120839994-120840016 CAGTGCTCTCCAAGAGCTGTGGG - Intergenic
1076276109 10:129200111-129200133 CAGTGTTCTCCCAGGGAAGTGGG - Intergenic
1076386743 10:130062566-130062588 CAGTGGTTTGCAAGGGCTGTTGG + Intergenic
1079469481 11:20764755-20764777 CTGTGTTCACAAAAGGCTGAGGG + Intronic
1081756820 11:45550660-45550682 CATTTTTCTCACAGGGCTATAGG - Intergenic
1082295351 11:50435198-50435220 CAGTGTTTTCAAACTGCTGAAGG - Intergenic
1082300278 11:50496299-50496321 CAGTGTTTTCAAATTGCTGAAGG + Intergenic
1082768045 11:57184098-57184120 CAGTGTTTCCACAGAGCTGTAGG + Intronic
1083142248 11:60731713-60731735 CATTGTTCTCAAACAGTTGTTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086072607 11:82815673-82815695 CAGTGTTCTCAAGGAGCTCAAGG - Intergenic
1086581640 11:88406726-88406748 AACTGTTCTCAAAGGCTTGTAGG - Intergenic
1088439029 11:109847897-109847919 CAGAATTCTCACAGGACTGTGGG + Intergenic
1089744334 11:120606517-120606539 GAGTGTGCTCACAGGCCTGTGGG - Intronic
1090158871 11:124470516-124470538 CAGTGTTGTCAGTGGGATGTAGG + Intergenic
1090189465 11:124758976-124758998 CCGAGTTCTCAAAGGGCGGAGGG + Intronic
1090616917 11:128522843-128522865 CCGTGTCCTCAAAGGGCTTTAGG + Intronic
1092482668 12:8874418-8874440 GAGTGTTCTTAATGAGCTGTGGG - Exonic
1093832198 12:23775930-23775952 CAGTTTTTTCCAAGGACTGTGGG + Intronic
1094636886 12:32235096-32235118 GTGTGTTTTCAAAGGACTGTAGG - Intronic
1096239630 12:49952826-49952848 CAGTGTCCTCAAAGGACACTTGG - Intronic
1099391414 12:82084479-82084501 CATTGTTCTCAAACAGTTGTTGG + Intergenic
1100786587 12:98085055-98085077 CAGTCTTTTCAAAGTGGTGTGGG + Intergenic
1101265837 12:103086164-103086186 CAGTTGTCTCAAATGGATGTTGG - Intergenic
1102480007 12:113216351-113216373 CAGTGTTGTCTAAGGGCTGGGGG + Intronic
1103098582 12:118152465-118152487 CAGTAGTCACCAAGGGCTGTAGG - Intronic
1105782756 13:23718403-23718425 CAGTGTTCTTGAAGGTCTTTGGG - Intergenic
1106110846 13:26775434-26775456 GAGTGTTTTCAAACTGCTGTTGG + Intergenic
1106196342 13:27497465-27497487 CAGTGTCCTCAACGTGCTGAGGG - Intergenic
1106341478 13:28832215-28832237 CATTGTTCTTAAATGCCTGTAGG + Intronic
1106770932 13:32959958-32959980 CAGTGTCCTCCCAGGGCTGGGGG - Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1108099888 13:46943820-46943842 CATTGTTCTCAAAGAGTTGTTGG + Intergenic
1111600946 13:90473223-90473245 AAGAGTTCACAAAGGGCAGTTGG - Intergenic
1111980739 13:95012886-95012908 TACTTTTCTCAGAGGGCTGTTGG - Intergenic
1112197641 13:97241718-97241740 CAGGGTTCTCCAATGGCTTTTGG - Intronic
1113508428 13:110832395-110832417 GAGTGTCCTCCCAGGGCTGTGGG + Intergenic
1113673453 13:112191186-112191208 CACTGTTCTTAAACGGTTGTTGG + Intergenic
1114204166 14:20552492-20552514 CATTCTTCTCAAAGAGCTGCAGG + Intergenic
1115193991 14:30776886-30776908 CAGCGTTCTCAACCGGCTGCCGG + Intergenic
1115199508 14:30837803-30837825 CATTGTTCTCAAACAGTTGTTGG + Intergenic
1115767255 14:36635813-36635835 CAGTGTACCCAAAGGTCTGAGGG + Intergenic
1119307220 14:73617254-73617276 CAGTGTTCTGGCAGGGCTTTTGG - Intronic
1120409825 14:84140447-84140469 CTGTATTCTCATAGGCCTGTTGG - Intergenic
1122155662 14:99748829-99748851 GAGTGTTTGCCAAGGGCTGTGGG - Intronic
1122706975 14:103628102-103628124 CAGGGTTCACAAAGGGCTGCTGG + Intronic
1122780168 14:104140117-104140139 TATAGTTCTCTAAGGGCTGTGGG + Intronic
1123172195 14:106384661-106384683 CAGTTTTGTCAAAGAACTGTTGG + Intergenic
1123400467 15:19980201-19980223 CAGTTTTGTCAAAGAACTGTTGG + Intergenic
1124708966 15:31989391-31989413 CAGTGTGCTCACATGGCTTTTGG + Intergenic
1124807484 15:32900200-32900222 CTGTGTACTCAATAGGCTGTCGG + Intronic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1127361450 15:58248104-58248126 AAGTTTTCCCAAAGGGCAGTGGG - Intronic
1127817511 15:62624701-62624723 CTGTGATGTCAAAGGGGTGTGGG + Intronic
1128372058 15:67047666-67047688 CATTGTTCCCAAAGGGTTATAGG + Intergenic
1129262659 15:74377373-74377395 CAGGGCTCTCACAGGGGTGTAGG - Intergenic
1129380568 15:75162838-75162860 CACTCATCTCAAAGGGTTGTTGG - Intergenic
1130345901 15:83044533-83044555 CTGTGTTTTCAAAGTGCTCTCGG - Intronic
1132329734 15:101003925-101003947 CCATGTGCTCAAAGGGCTGCTGG - Intronic
1134016393 16:10891411-10891433 CAGTTTTCTCACAGGGCATTGGG - Intronic
1135323774 16:21513225-21513247 CAGTGGACTCAAAGGCCAGTTGG - Intergenic
1136335257 16:29606490-29606512 CAGTGGACTCAAAGGCCAGTTGG - Intergenic
1137382131 16:48009344-48009366 CCCTGTCCTCAAAGGGCTGAAGG + Intergenic
1138165847 16:54801021-54801043 CAGTGATCTCAAAGGCCTGGTGG + Intergenic
1138423996 16:56918251-56918273 CACTGCTCTCAAAGAGCTGCAGG - Intergenic
1139614844 16:68082708-68082730 CAGGGCTCTCAGAGGGCTGAAGG + Intergenic
1140072042 16:71659023-71659045 CAGTGTGTTTCAAGGGCTGTTGG + Intronic
1140404116 16:74696481-74696503 CATTTTTCTTAAAGGACTGTAGG - Intronic
1142035982 16:87862332-87862354 CAGTGGACTCAAAGGCCAGTTGG - Intronic
1142373828 16:89696891-89696913 GAGTGTCCTCAAGGGCCTGTTGG - Exonic
1143047696 17:4095325-4095347 CAGTGTTATGAATGTGCTGTAGG - Intronic
1144421242 17:15101097-15101119 CAGTCTTCTTAAAGAGCTGGTGG + Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1160431005 18:78812520-78812542 CCCTGTTCTCAAGGGGCTGATGG - Intergenic
1163362651 19:16857210-16857232 CATTGTTCTCAAACAGTTGTTGG + Intronic
1163848531 19:19650782-19650804 CAGTGTTGCCACAGGGCTGCTGG - Intronic
925377356 2:3397441-3397463 CAGAGCTCACACAGGGCTGTGGG - Intronic
925818563 2:7777192-7777214 CAGTGCTCACAAATGGCTGGTGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
929352633 2:40977058-40977080 CAGTGTTTTCAAAGTGATATTGG + Intergenic
930168362 2:48225934-48225956 CGGTGAACTGAAAGGGCTGTAGG + Intergenic
930570991 2:53087008-53087030 CATTGGCCTCAAAGGGCTGTTGG - Intergenic
930635105 2:53796062-53796084 CGGTATTTTCAAAGGTCTGTTGG - Intronic
930765361 2:55079775-55079797 CAGTATTCAGACAGGGCTGTTGG - Intronic
931234385 2:60401008-60401030 CACTGTTCTCCAGTGGCTGTTGG + Intergenic
936837173 2:116722728-116722750 CAATGTGCTGAAAGAGCTGTAGG - Intergenic
938804087 2:134789705-134789727 CAGGGTTCACTGAGGGCTGTTGG + Intergenic
938815293 2:134896925-134896947 TAGTGTTTTCCAAGGGCTGGAGG + Intronic
939162159 2:138603622-138603644 CTGTGTTCTCACAGGGTTGAAGG + Intergenic
942650689 2:178164341-178164363 CTGTGTTCTCAAATGGTTGAAGG + Intergenic
946279026 2:218652837-218652859 CCTTGTTGTCATAGGGCTGTTGG - Intronic
946823744 2:223655697-223655719 CTGTGTCCTCAAATGGCTGAAGG - Intergenic
948237606 2:236402259-236402281 CCGTGGTCTCAGGGGGCTGTGGG - Intronic
1170612556 20:17926438-17926460 CAGTGATCTCAAGGGGCTGTAGG - Intergenic
1171446004 20:25205450-25205472 CACTGTTCTCAGAGCACTGTGGG + Intronic
1172133588 20:32672829-32672851 CTGTCTTCCCACAGGGCTGTGGG + Intergenic
1172636800 20:36415602-36415624 CAGTGTCCTCAAAGGGTTGTTGG - Intronic
1173398459 20:42702678-42702700 CAGTGTTCTCAAAGTTCTGTAGG - Intronic
1174117603 20:48237970-48237992 GAGGGTTCTCAAGGGGCTGGGGG - Intergenic
1174271652 20:49373724-49373746 GAGTGATGTCAAAGGGCTGTGGG + Exonic
1176326886 21:5509110-5509132 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176400871 21:6311841-6311863 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1176436286 21:6677263-6677285 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176460548 21:7004333-7004355 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176484109 21:7386111-7386133 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176976171 21:15325108-15325130 CAATAGTCTCACAGGGCTGTTGG - Intergenic
1178257515 21:31067875-31067897 CAGAGTTCACAAAGGAATGTGGG - Intergenic
1179101883 21:38361408-38361430 CAGTCTTCCCTAATGGCTGTTGG + Intergenic
1180633168 22:17243866-17243888 GAGTGCTCCCAAAGGGCTGTGGG - Intergenic
1182626508 22:31650756-31650778 CAGTGATCTCACAGGGATGGAGG + Intronic
1183429382 22:37756497-37756519 CAGAGTTCACAAAGTGCTCTGGG - Intronic
1184354874 22:43973011-43973033 CAGTGTACTCAATGATCTGTTGG - Intronic
1184716523 22:46285550-46285572 AAGTGATCTGAAAGGGCTGGAGG - Intronic
950198844 3:11028665-11028687 CAGTGTGCTGGAAAGGCTGTAGG + Intronic
951824541 3:26853560-26853582 CAGTGTTTAAAAAGGGCTTTTGG - Intergenic
952299384 3:32090610-32090632 CATTGTTCTCAAAGAGTTGTTGG - Intergenic
952316214 3:32234878-32234900 CAGCACTCTCAAAGGTCTGTAGG - Intergenic
952420377 3:33125191-33125213 CAGTGTTCTCAAACCACTTTGGG - Intronic
953376037 3:42429347-42429369 CAGCCATCTCAAAGGGCTGGTGG + Intergenic
954566694 3:51606034-51606056 CAGTGCTCTCACAGGTCTCTGGG - Intronic
956659834 3:71586037-71586059 CAGTGATGTCAAAGAGTTGTTGG - Intergenic
956722314 3:72129027-72129049 TGGTGTTCTCACATGGCTGTTGG + Intergenic
957124176 3:76136377-76136399 CAGTGTTCAGAAATTGCTGTTGG + Intronic
957377917 3:79383046-79383068 AAGAGTTCTCAATGGGCTGCTGG + Intronic
958784378 3:98581646-98581668 GAGAGCTCTCAATGGGCTGTAGG - Intronic
961810492 3:129519022-129519044 GAGTCTTCTCACAGGGGTGTAGG + Intronic
968443787 4:637960-637982 CACTGTTCTCCACGGGGTGTGGG - Intronic
969937485 4:10696589-10696611 CAGTGGGCTGTAAGGGCTGTAGG + Intergenic
973803909 4:54506156-54506178 CAGTGTTCTTAAAGTTTTGTTGG - Intergenic
974180046 4:58372636-58372658 CAGTGTTGTCAAAGATCAGTTGG + Intergenic
974450335 4:62048079-62048101 CAGTCTCCTCCCAGGGCTGTTGG + Intronic
974597963 4:64037621-64037643 GACTGTTCTCAATGAGCTGTTGG - Intergenic
976631348 4:87240063-87240085 AAGTGTTCTCAAAGTGCTGTGGG - Intronic
977390565 4:96403559-96403581 CAGTCTACTCACATGGCTGTTGG - Intergenic
979264646 4:118687094-118687116 CAGTGTTTGCACAGGGTTGTGGG - Intronic
979582698 4:122379196-122379218 CAGTGCTCTGTCAGGGCTGTAGG + Intronic
982019932 4:151192699-151192721 CAGCGTTCACAAAGGCTTGTAGG - Intronic
983472274 4:168172249-168172271 CAGTGTGCTTAAAGTGCTCTTGG + Intronic
983655550 4:170080069-170080091 CAGTGTTTTCAAAAGGGTGGGGG + Intronic
985442446 4:189992893-189992915 CTGTGTTCTCATGGGGTTGTCGG + Intergenic
985536216 5:467086-467108 CTGTGCTGTCAAAGGCCTGTGGG + Exonic
986055480 5:4132617-4132639 TCGTGTCCTCAAAGGGCTGGGGG - Intergenic
987217910 5:15757791-15757813 CAGAAATCTCAAAGGGCTGAAGG + Intronic
988714137 5:33808200-33808222 CAGTTTTCTGAAATGGCTGTGGG + Intronic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
991016713 5:61940939-61940961 CAGTGTTCCCAAGGAGCTCTGGG + Intergenic
992521194 5:77553337-77553359 CTGTGTTCTCAAATAGCTGAAGG + Intronic
993020689 5:82586839-82586861 CTGTTCTCTCAAAGGCCTGTTGG + Intergenic
995064523 5:107844869-107844891 CTGTTTTGTCAAAGTGCTGTGGG - Intergenic
995119370 5:108519664-108519686 CAGGGTTTTCCAGGGGCTGTCGG - Intergenic
997383782 5:133456565-133456587 CAGTGACCACCAAGGGCTGTTGG - Intronic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
1003011749 6:2433489-2433511 CAGTGTCCACATAGGGCTATGGG - Intergenic
1003172791 6:3733347-3733369 CCATTTTCTCAAAGGGATGTTGG + Intronic
1003978529 6:11367196-11367218 CAGTGGTCTGAAAGTGCAGTGGG + Intronic
1003988758 6:11464719-11464741 CAGTGTTATCAAATAGCTGCTGG - Intergenic
1004265028 6:14141928-14141950 CAGCCATCTCACAGGGCTGTTGG - Intergenic
1006583727 6:35091896-35091918 AAGTGTTCCCAGAGGGCTGGTGG + Intergenic
1008093907 6:47319214-47319236 CAGTTTACTCAAAAGGCAGTGGG + Intergenic
1008909486 6:56717739-56717761 GAGTGCTATCATAGGGCTGTTGG - Intronic
1009063462 6:58425932-58425954 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1009251127 6:61300518-61300540 CAGTGTTTCCAAATGGCTGAAGG + Intergenic
1017563295 6:155656720-155656742 CAGTGATATCACAAGGCTGTAGG - Intergenic
1018588610 6:165390592-165390614 CAGTGTTCTCCAAGAGGTGGAGG + Intronic
1019149033 6:169992365-169992387 CAGTGTTCTGAGAGGCGTGTGGG - Intergenic
1019747200 7:2707602-2707624 CTGTGATCTCACAGTGCTGTGGG + Intronic
1020965806 7:14866413-14866435 TAGTGTTTGCAAAGGGTTGTGGG - Intronic
1021109969 7:16682293-16682315 CAGAGTTCTAACAGGACTGTAGG + Intronic
1024827268 7:53405962-53405984 CAGTCTTATAAAAGGGCTGGAGG + Intergenic
1028295984 7:89132109-89132131 CAATGTGCTGAAAGGCCTGTAGG + Intronic
1029576417 7:101406502-101406524 AAGTGCTCTCAGGGGGCTGTTGG + Intronic
1030490781 7:110231372-110231394 CTGTGTCCTCACAGGGCTGAAGG - Intergenic
1031384732 7:121134770-121134792 CAGTATTCTCATAGTGCTGGTGG + Intronic
1041113676 8:54512434-54512456 CACCCTTATCAAAGGGCTGTAGG + Intergenic
1042523444 8:69739242-69739264 CAGTGTTTACAAGAGGCTGTAGG - Intronic
1042523463 8:69739799-69739821 CAGTGTTTACAAGAGGCTGTAGG - Intronic
1044472115 8:92582374-92582396 TAAAGTTGTCAAAGGGCTGTGGG - Intergenic
1046351034 8:113012785-113012807 CTGTATTATCAAAGGGATGTTGG - Intronic
1046581284 8:116095499-116095521 CAGTCGTCTCAAAGAGCTGTAGG + Intergenic
1047475139 8:125220723-125220745 CAATCTTCTGAAAGGGCTTTTGG - Intronic
1047825077 8:128564623-128564645 TAGTGTTCTGATAGGGCTGATGG + Intergenic
1048051413 8:130820532-130820554 CAGGGTTCTCAAAGACCAGTAGG - Intronic
1049797354 8:144502879-144502901 GGGTGTCCTCACAGGGCTGTGGG + Intergenic
1049939851 9:535096-535118 CAGTGTTCTCAGACTGCAGTGGG + Intronic
1049983374 9:925184-925206 CAGTGTTCTCAGATGGCTCCCGG + Intronic
1051349636 9:16186752-16186774 CTGTCTCCTCAAAGGCCTGTTGG - Intergenic
1051891024 9:21943139-21943161 CAGTGTTCTCAAAGGAGAGTTGG + Intronic
1053008044 9:34617116-34617138 CAGAGTTCCCAAAGGGCTCTTGG - Intronic
1054815619 9:69472303-69472325 CAGCGTTCTCACAGCACTGTTGG + Intronic
1055836167 9:80445476-80445498 CAGTGTTTTGACAGGGCTGTTGG - Intergenic
1056080432 9:83087449-83087471 CTGTGTTCTCACATGGCAGTAGG - Intergenic
1058616208 9:106830688-106830710 CAGTGTTCTCTTCGGGCTGCTGG - Intergenic
1058754288 9:108070218-108070240 CACTTTTCTCATAGGGCTTTTGG + Intergenic
1059066957 9:111095577-111095599 CAGAGCTCTCAAATGGCTCTTGG - Intergenic
1060371983 9:123082417-123082439 CAGTTGTATGAAAGGGCTGTGGG - Intronic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1061683883 9:132259231-132259253 CATGCTTCTCAAAGGGCTGGAGG - Intergenic
1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1185830697 X:3300213-3300235 CATTGTTCTCAAAGGTCCCTTGG + Intergenic
1186402065 X:9269286-9269308 CAGGGTTCTGAAAGGGATCTGGG + Intergenic
1186837104 X:13449081-13449103 CAGTGACCTCAAAGCACTGTGGG - Intergenic
1188741477 X:33788019-33788041 CATTGTTCTCAAAGAGTTGTTGG - Intergenic
1190738432 X:53271144-53271166 CAGTGTCCGCAAAGGCCTGGAGG - Intronic
1195703841 X:107724331-107724353 CAGGGATCTCAAAGGAGTGTTGG + Intronic
1196655867 X:118216571-118216593 CAGTGTTATTACAGAGCTGTTGG + Intergenic
1198439700 X:136651213-136651235 CAGTGTTCTGAAAGGGACATAGG - Intronic
1199406032 X:147461836-147461858 CATTTTTTTCATAGGGCTGTTGG - Intergenic