ID: 999101493

View in Genome Browser
Species Human (GRCh38)
Location 5:149029261-149029283
Sequence CTGTGTTTGTAAAAGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999101489_999101493 0 Left 999101489 5:149029238-149029260 CCATGTGTCCACTGGGCTGGACA 0: 1
1: 0
2: 3
3: 17
4: 183
Right 999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG 0: 1
1: 1
2: 1
3: 35
4: 263
999101485_999101493 20 Left 999101485 5:149029218-149029240 CCACTTGGCAGACATTGGTTCCA 0: 1
1: 0
2: 0
3: 16
4: 137
Right 999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG 0: 1
1: 1
2: 1
3: 35
4: 263
999101490_999101493 -8 Left 999101490 5:149029246-149029268 CCACTGGGCTGGACACTGTGTTT 0: 1
1: 0
2: 2
3: 31
4: 277
Right 999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG 0: 1
1: 1
2: 1
3: 35
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999101493 Original CRISPR CTGTGTTTGTAAAAGTGGCA GGG Intronic
900369900 1:2327640-2327662 CTGTGCTTCTAAAAGCCGCACGG - Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
902719301 1:18293393-18293415 CTGCTTTTGTAAAAATGGGAAGG + Intronic
903406586 1:23102396-23102418 CTGTGTTGGGAGAAGGGGCAGGG - Intronic
905605400 1:39294204-39294226 CTTCGTTTGTAAAAATGGGAAGG + Intronic
906120744 1:43389009-43389031 CTGAGCTTGTGAAAGAGGCACGG - Intronic
906166425 1:43689777-43689799 CTGTGGTGGTTAAAGTGGCATGG + Intronic
906978361 1:50600506-50600528 TTGTGTGTGTATATGTGGCAAGG - Intronic
908099585 1:60777145-60777167 CTGTGTACCTAAAAGTGGCGGGG - Intergenic
908237666 1:62162646-62162668 CTCTGTTTTTAAAAGTACCATGG + Exonic
909431879 1:75597575-75597597 CTGTTTTTGTAACAGTACCATGG - Intronic
909950967 1:81719969-81719991 ATTTGTTTCTAAAAATGGCAGGG - Intronic
910096722 1:83531068-83531090 CTGTGTTTGAAAAACTAGCATGG - Intergenic
910794607 1:91085172-91085194 GTGTGTTTGTATATGTGGAAGGG + Intergenic
912812784 1:112806406-112806428 CAGTGTTTGTACAAATTGCAGGG + Intergenic
913268654 1:117070778-117070800 TTGTGTTTGTACAAGAGGGAGGG + Intronic
913808660 1:122844182-122844204 CTCTTTTTGTGGAAGTGGCAGGG + Intergenic
913828204 1:123193965-123193987 CTGTGTTTGTAAAGTCTGCACGG + Intergenic
914217614 1:145647246-145647268 CTGTGTTTGGAAAATTTTCATGG + Exonic
914260374 1:145994218-145994240 CTGGGTTTGTAAAATTGTGATGG - Intronic
914470180 1:147969938-147969960 CTGTGTTTGGAAAATTTTCATGG + Exonic
915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG + Intronic
916137312 1:161665144-161665166 CTGAGTATGTAAGATTGGCAAGG - Intronic
916629284 1:166594299-166594321 CTGTGTTGTTAGAAGTAGCAAGG - Intergenic
917672782 1:177288981-177289003 CTATGTTTGAAGAAGAGGCAAGG + Intergenic
918694792 1:187532027-187532049 ATGAGTTTCTTAAAGTGGCAGGG - Intergenic
919761040 1:201098389-201098411 CTGGGTTTGTCAAAGTCACATGG + Intronic
921673389 1:217951058-217951080 CTGTGGTTGGAAGAGAGGCACGG + Intergenic
921928813 1:220736294-220736316 TTGTGTTTTTAGAAGAGGCAGGG - Intergenic
922510314 1:226160679-226160701 CTGAGTTTGTAGGGGTGGCATGG - Intronic
922654633 1:227370833-227370855 ATTTATTAGTAAAAGTGGCAAGG + Intergenic
923083722 1:230685220-230685242 CTGTGTTTGTCAATGAGGTAAGG + Exonic
923598374 1:235378926-235378948 TTGTGCTTGCAAAAGGGGCACGG + Intronic
923709817 1:236378261-236378283 TTGTGTTTGTAGAAGAGGGAGGG - Intronic
924230286 1:241957091-241957113 GTGTGTGTGTAAAAGGGGCATGG + Intergenic
924335779 1:242985818-242985840 CTTTGTTTTTGAATGTGGCATGG - Intergenic
924808904 1:247384045-247384067 GTGTGTTTGTATATGTGGAAGGG - Intergenic
1064269015 10:13848630-13848652 GTGTGTGTGTAAACGCGGCAGGG + Intronic
1064298428 10:14099996-14100018 CAGTGTTTGTATAAATGGCAGGG - Intronic
1064664124 10:17632196-17632218 TTGTGTTTGTGACAGTGACAGGG + Intergenic
1066805583 10:39248654-39248676 CTGTTTTTGTAAAATCTGCAAGG + Intergenic
1067695762 10:48534458-48534480 CTGTGTTTGTCCATATGGCAAGG - Intronic
1067880125 10:50035770-50035792 CAGTGTTTGAAAAAGTGGCAGGG + Intergenic
1067882069 10:50054373-50054395 TTGTCTTTTTAATAGTGGCAGGG + Intergenic
1068078231 10:52285106-52285128 CTGGGGTTGTAAGAGGGGCAGGG - Intronic
1069028667 10:63571908-63571930 CTGTGTTTCTAAAGGTAGCATGG - Intronic
1069712084 10:70496175-70496197 CTGTGTGTGGAAACATGGCAAGG - Intronic
1070079583 10:73172180-73172202 TTGTCTTTGAAAAAGTGGAAAGG - Intronic
1070439453 10:76429011-76429033 GTGTGTGTGTATAATTGGCAGGG - Intronic
1071357436 10:84812302-84812324 GTGTGTTTGTATATGTGGAAGGG - Intergenic
1073818013 10:107228828-107228850 CTGTGTTTGTATAACAGGCCTGG + Intergenic
1074366690 10:112863192-112863214 CTATGTTTCTAAAAGGGGCTTGG - Intergenic
1075737943 10:124675572-124675594 CTGTGTCTGTAAAATGGGAATGG - Intronic
1077235172 11:1478508-1478530 CTGGGTTTCTAAAAGTGCCACGG + Intronic
1078275456 11:9840823-9840845 CTGTGATTGTAAAACTGTGAGGG - Intronic
1078661737 11:13292982-13293004 CTCTGTTTTTAAGGGTGGCAAGG + Intronic
1079850737 11:25530932-25530954 CTGTGTTTTTAATAGAGACAGGG + Intergenic
1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG + Intronic
1081584919 11:44377548-44377570 CTGTGGCTGTAAAGGTGGCTTGG + Intergenic
1081605069 11:44521951-44521973 TTGTGTTTTTAATAGAGGCAGGG - Intergenic
1082080189 11:48006724-48006746 CTGTCTCTGTTCAAGTGGCAAGG + Intronic
1085089667 11:73700265-73700287 CTTTGTTTTTGAAAGTGGTATGG - Intronic
1086320144 11:85637622-85637644 TTGTCTTTGTAAAGCTGGCAAGG + Intergenic
1086413650 11:86567919-86567941 CTGTGTATGTAAAAAAGTCATGG + Intronic
1087966672 11:104423242-104423264 CTGTGTTTGTAAAAGGAACAGGG + Intergenic
1088312401 11:108473934-108473956 CTCTGTTATTAAAGGTGGCATGG - Exonic
1089044555 11:115488814-115488836 CTGTGTTTAAAAAAATGACATGG - Intronic
1090559953 11:127921017-127921039 CTTTGTCTGTAAAAGAGGTAAGG - Intergenic
1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG + Intergenic
1095403387 12:41840593-41840615 CTCTCCTTGTAAAAGTGCCAAGG + Intergenic
1096058762 12:48678890-48678912 TTCTGTATATAAAAGTGGCATGG - Intronic
1096088733 12:48883938-48883960 CTGTGTGTGTCAGTGTGGCAAGG - Intergenic
1096409522 12:51366953-51366975 TTGTATTTTTAATAGTGGCAGGG - Intronic
1096823581 12:54256878-54256900 CTGTGTTTTTAGTAGAGGCAGGG - Intronic
1098185638 12:67893222-67893244 TGCTGTTTGGAAAAGTGGCAGGG + Intergenic
1098456841 12:70684046-70684068 CTGTGTTAGTAAAATTGCCATGG - Intronic
1099083232 12:78212627-78212649 CTGTGTTTCTCAAAATGGCAGGG - Exonic
1099728963 12:86473127-86473149 TTGTGTTTTTAGAAGAGGCAGGG + Intronic
1100538917 12:95539398-95539420 CTGTATTTGTAATAGAGACAGGG + Intronic
1101148644 12:101865136-101865158 GTGTGTTTGTATATGTGGAAGGG - Intergenic
1105829570 13:24151992-24152014 CTGGTTTTCTAAAGGTGGCAGGG + Intronic
1106004188 13:25753195-25753217 CTGTATGAGCAAAAGTGGCAGGG + Intronic
1108757552 13:53522250-53522272 CTGTGGTTGTGAAAGTGAAAGGG + Intergenic
1109523290 13:63541532-63541554 CTTGGTTTGTAAAACTGGCAAGG + Intergenic
1109957793 13:69591033-69591055 CTGTATTTTTAGAAGAGGCAGGG + Intergenic
1110549276 13:76793671-76793693 CTGTGGTTGGAAGAGTGGGATGG - Intergenic
1112190260 13:97170387-97170409 CTTTGTTTGTGCAACTGGCAGGG - Intergenic
1113023412 13:105914369-105914391 CTGTTTTTGTAAATGTTCCAAGG + Intergenic
1116495789 14:45558602-45558624 TTGAGTTTGTAAAATTAGCAAGG - Intergenic
1116810915 14:49539455-49539477 CCTTGTTTGTAAAAATGGAAAGG + Intergenic
1116853640 14:49932563-49932585 CAGTGTTGGTAGAACTGGCATGG - Intergenic
1117418144 14:55517210-55517232 CTGTTTTTGTAAAAATGAGAAGG - Intergenic
1117542811 14:56764842-56764864 CTGTGTTCTTGAAAGTTGCAGGG - Intergenic
1117817380 14:59611842-59611864 CTGTGTTTGTATATGTGGAAGGG + Intronic
1117967949 14:61224862-61224884 CTGTGTGTGGTAAATTGGCAGGG + Intronic
1119180167 14:72600115-72600137 CTGTGTGTGTATGTGTGGCAGGG - Intergenic
1119335898 14:73833549-73833571 CTGTGTTTTTATAAGTAGGAGGG + Intergenic
1119863180 14:77951774-77951796 CTGTGTCTGTGAGAGTGGAAGGG + Intergenic
1119937283 14:78603433-78603455 CTGTGTTTTCACAAGTGGCACGG - Intronic
1120413395 14:84187849-84187871 CTGTAATTGGAAGAGTGGCATGG + Intergenic
1120853389 14:89190947-89190969 ATGTGTTTGTAACAGTGGTGTGG + Intronic
1121154947 14:91674263-91674285 CTGTATTTCTAAAACTGGAAGGG + Intronic
1121438123 14:93932200-93932222 CAGTGTTTGACTAAGTGGCATGG + Intergenic
1121693207 14:95892540-95892562 CTATGTTTGGGGAAGTGGCATGG + Intergenic
1122587724 14:102821260-102821282 CGGTGTTACTAAAAGTGTCACGG - Intronic
1124698674 15:31891480-31891502 CAGTGTTAATAAAAGGGGCAGGG - Intergenic
1125525488 15:40371471-40371493 CTGTGGCTGTAGAAGAGGCACGG - Intergenic
1125925797 15:43562045-43562067 CTGGCTTTGGAAAAGAGGCAAGG - Intronic
1125938941 15:43661596-43661618 CTGGCTTTGGAAAAGAGGCAAGG - Intronic
1128197803 15:65775917-65775939 CTGAATTTGCAAAGGTGGCATGG - Intronic
1128776930 15:70327838-70327860 CTGGGCTTGCTAAAGTGGCAGGG - Intergenic
1128854272 15:70994017-70994039 TTGTATTTTTAAAAGAGGCAGGG + Intronic
1130023394 15:80249988-80250010 CAGTGTTTATAAAACTGACATGG - Intergenic
1130416186 15:83696739-83696761 CAGTGTTTGTAGCAGTGACAAGG + Intronic
1130837405 15:87664255-87664277 GTGTGTTTGTATACGTGGAAGGG + Intergenic
1130998829 15:88921739-88921761 GTATGTTTGTAAATGTGGAAGGG + Intergenic
1131492048 15:92871605-92871627 CTGTGTTATTAAAAATTGCATGG - Intergenic
1131566113 15:93487012-93487034 CTGTGTTGGGAAAGGTGGCATGG - Intergenic
1131996952 15:98142554-98142576 TTATATTTGTAAAAGGGGCAAGG - Intergenic
1134329144 16:13234830-13234852 CTTTGTTTGTGAAAAGGGCATGG + Intronic
1134755719 16:16665580-16665602 GTGTGTGTGTATAAGAGGCAGGG + Intergenic
1134971112 16:18531732-18531754 TTGTGATTGTAAAATTGGCCTGG - Intronic
1134990347 16:18693585-18693607 GTGTGTGTGTATAAGAGGCAGGG - Intergenic
1136302421 16:29344867-29344889 TTTGGTTTGTAAAAGTGGAAAGG - Intergenic
1137079305 16:36026174-36026196 CTGTTTTTGTAAAATCTGCAAGG + Intergenic
1138827361 16:60336622-60336644 CTATGTCTTCAAAAGTGGCAAGG - Intergenic
1138976667 16:62215855-62215877 GTGTGTGTGTATATGTGGCAGGG + Intergenic
1139835097 16:69831999-69832021 TTGTGTTTTTAATAGAGGCAGGG + Intronic
1141422837 16:83927960-83927982 GTGTGTTTGTAATAGAGCCAGGG + Intronic
1142718727 17:1762573-1762595 CTGATTTTGAAAAAGTAGCAGGG - Intronic
1147012130 17:37458681-37458703 CTGTGTCTGTGAGAGAGGCAAGG + Intronic
1150241487 17:63637163-63637185 CTCAGTTTTTAATAGTGGCAGGG - Intronic
1150615375 17:66766536-66766558 GTTTGTTTTTAACAGTGGCAGGG - Intronic
1150868083 17:68875702-68875724 CCGTGTTTCTAAAGGTGGCCCGG + Exonic
1152231617 17:79116848-79116870 CAGTGGTTGTCAAAGTGGCCTGG + Intronic
1153368824 18:4290090-4290112 CTGTGTTTGAAAAGCTTGCAGGG - Intronic
1157200219 18:45653467-45653489 GTGTGTATGTGAAAGTGGCAGGG + Intronic
1158113799 18:53972214-53972236 TTGTGTTTGTATAAATGACAGGG - Intergenic
1158750147 18:60249447-60249469 CTGTGTGTATACAAGTGCCATGG - Intergenic
1159072713 18:63643999-63644021 CTGTGTTCCTAAAAGTGCCTTGG + Intronic
1159074158 18:63661636-63661658 CTGTGTTCCTAAAAGTGCCTTGG + Intronic
1161150846 19:2708075-2708097 TTGTATTTGTAATAGAGGCAAGG + Intergenic
1163788131 19:19288055-19288077 CTTTTTTTTTAAAAGAGGCAGGG + Intronic
1168383762 19:55945752-55945774 TTGTGTTTTTAATAGAGGCAGGG + Intergenic
926203275 2:10816572-10816594 CTGTATTTTTAAAAGTGGGGAGG - Intronic
926300967 2:11601981-11602003 CTGTGTGAGTAAAATTGGCTAGG + Intronic
926419589 2:12683574-12683596 CTTCGTTTGTAAAAGTAACAAGG - Intergenic
926716856 2:15931387-15931409 CTGTCACTGTAAAAGTGACATGG + Intergenic
928248530 2:29653536-29653558 CTTTGTCTGTAAAAGGGTCATGG + Intronic
928364870 2:30692680-30692702 CTGTGTTTATTAAACTGGCCTGG - Intergenic
929243590 2:39677644-39677666 CTGTGTTTGGAGGAGTGGGATGG + Intronic
932893057 2:75612562-75612584 CTGTATTTGTTAAAGTGGTGAGG - Intergenic
935413224 2:102787730-102787752 TTGTGTTTCTAAAAGTTGCTTGG - Intronic
937601412 2:123739842-123739864 CTTTGTTTATACAACTGGCAGGG - Intergenic
940184472 2:150968195-150968217 CTATGTATCTAAGAGTGGCATGG + Intergenic
940240534 2:151558577-151558599 CTGTTTTGGTAAAAGTACCATGG - Intronic
941771742 2:169352561-169352583 CTGTATTTTTAAAAGTTTCAAGG - Intronic
942297126 2:174528454-174528476 CTGTGAATGTACAAGTGCCATGG + Intergenic
944112300 2:196145617-196145639 ATGTGGTTGTAAGAGTGGGATGG + Intronic
944776577 2:202972946-202972968 CTTTTTTTGTAAAAGAAGCAGGG + Intronic
944989678 2:205221281-205221303 CTGAGGTTGTAAAAGGAGCAAGG - Intronic
946389751 2:219408434-219408456 CTGTGTCTGTAAAAGGAGCGTGG + Intergenic
947341568 2:229145716-229145738 CAGTGTTTGTAAAAGATTCACGG - Intronic
947584414 2:231344657-231344679 CTGGGTTTGTAAAAATGAGAAGG - Intronic
948229756 2:236341415-236341437 GTGTGTTTGTAAAAGTGGCAGGG + Intronic
1169640083 20:7741805-7741827 TTGAGTTTATAAAAGTGGCTGGG - Intergenic
1169711205 20:8565701-8565723 TGGTGTAAGTAAAAGTGGCAAGG + Intronic
1169852847 20:10071449-10071471 GTATGTTTGTAAAAATGGCAAGG - Intergenic
1170920631 20:20676077-20676099 CACAGTTTGTAAAAGTGGGAGGG + Intronic
1171034226 20:21703395-21703417 CCGAGCTTGGAAAAGTGGCAAGG - Intergenic
1172655792 20:36536976-36536998 CTGTGTTTGTATTAGAGCCAGGG - Intergenic
1172701676 20:36857040-36857062 CTCTCTTTGTAGAAGAGGCAGGG + Intronic
1173123401 20:40314867-40314889 CTGAGGTTGTAAAAGTGCAAAGG - Intergenic
1175833724 20:61980680-61980702 CTGTGTTTGGAAGAGAGGCTGGG - Intronic
1177109402 21:17006497-17006519 CTGTTTTTGTACCAGTAGCATGG - Intergenic
1177497471 21:21908702-21908724 CTTATTTTGTGAAAGTGGCAAGG + Intergenic
1177528249 21:22326659-22326681 TTGTGTTTTTAATAGAGGCAGGG + Intergenic
1177539665 21:22475985-22476007 CTCTGTGTGTAAAAGTAGGATGG + Intergenic
1178253372 21:31026929-31026951 CTTTGTATGAAAAACTGGCAAGG + Intergenic
1180057111 21:45364704-45364726 GGGTGTTTGAAAAAGGGGCAGGG + Intergenic
1180637067 22:17269794-17269816 CTGGGTGGGTAGAAGTGGCAGGG - Intergenic
1182602534 22:31477803-31477825 CTTGGGTTGTAAAAGTGGCAGGG + Intronic
1182889703 22:33807042-33807064 CTGTCTTTGTGGAAGTTGCATGG - Intronic
1184264640 22:43340469-43340491 GTGTGTGTGTAAAAGAGACAAGG - Intronic
1184608616 22:45588498-45588520 CTGTGTGTGTATAAGAAGCAAGG - Intronic
1185243850 22:49762674-49762696 CACTGTTTTTAAATGTGGCATGG - Intergenic
949122283 3:401072-401094 CTGTGTTTTTAATAGAGACAGGG + Intronic
949627626 3:5885693-5885715 CTATGTTTGTATAAGAGTCATGG + Intergenic
950330869 3:12155138-12155160 CTGAGGTTCTAAAAGAGGCATGG - Intronic
951372085 3:21861851-21861873 CTGTGTGTGTCAAAGTCTCAAGG - Intronic
951790355 3:26476145-26476167 CTGACTGTGTAAAATTGGCACGG + Intergenic
952144893 3:30521502-30521524 CTGTGTTTGGATGAGTGGTATGG - Intergenic
952387145 3:32850116-32850138 CTGCCTTTGGAAAAGAGGCACGG - Intronic
953534762 3:43769375-43769397 CTGGGATTGTGCAAGTGGCAGGG - Intergenic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
955569171 3:60285540-60285562 CTGTGTTTGAACAAGTGGGGAGG - Intronic
955820298 3:62889480-62889502 CTGTGACTGTAAGATTGGCATGG - Intergenic
959789410 3:110340161-110340183 CTGTGTTTGTCAATGTCACATGG + Intergenic
964761899 3:160142227-160142249 CTTTTTTTCTGAAAGTGGCAGGG + Intergenic
966282829 3:178254677-178254699 CTGTGTTTGTAGCAGTAGCTGGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967744620 3:193041316-193041338 GTGTGTGTGTAAAAATGACAGGG - Intergenic
969936746 4:10689610-10689632 CTATGTTTGTGTAAGTTGCAAGG - Intergenic
970187824 4:13481586-13481608 CAGTGTTTGTAAATGTAGCATGG - Intronic
971302781 4:25455786-25455808 CTTTGGTTGCAAAAGTGGAAAGG + Intergenic
972400628 4:38699031-38699053 CTGTGTTAATAAAAGTTGTAGGG + Exonic
972522223 4:39869932-39869954 TTGTGTTTTTAGAAGAGGCAGGG - Intronic
974379551 4:61120956-61120978 CAGTCTATGTAAAAGGGGCACGG - Intergenic
974410830 4:61539297-61539319 CTGTGTCTGTAACAGTGGGTTGG + Intronic
979150047 4:117300338-117300360 CCGTGTATCTAAAACTGGCAGGG + Intergenic
980433256 4:132732405-132732427 CTCAATTTGTAAAAGTGGTAAGG - Intergenic
981096958 4:140791909-140791931 CTCAGATTGTCAAAGTGGCAGGG - Intergenic
981254493 4:142645568-142645590 CTGTTTTTCTAAAAGTGGGAAGG - Intronic
982225430 4:153161246-153161268 CTGTGCTTGTAAAAGCAGTAGGG - Intronic
984746927 4:183230132-183230154 TTGTTTTTTTAAGAGTGGCAGGG + Intronic
986074185 5:4317715-4317737 CTATGTGTGTATAAATGGCAAGG + Intergenic
986341922 5:6796517-6796539 CTGTGTTGGGAAAAGTGGATGGG + Intergenic
987122590 5:14781113-14781135 CTGAGTTTTGAAAAGTGGCTTGG + Intronic
988164124 5:27561285-27561307 GTGTGTTGTTAAAAGTGGCCAGG + Intergenic
989833591 5:45953400-45953422 CTGTTTTTGTAGAATCGGCAAGG + Intergenic
989834990 5:45977203-45977225 CTGTTTTTGTAGAAGCTGCAAGG + Intergenic
989841690 5:46082025-46082047 CTGTTTTTGTAGAATCGGCAAGG + Intergenic
990081036 5:51913843-51913865 CTGTTCTTGTCAAAGTGGCCTGG + Intergenic
994140191 5:96333322-96333344 CTATGTTTGGAAAAGAGGCTTGG + Intergenic
994488775 5:100414727-100414749 ATGTGTTTGTATAAGTAGCATGG + Intergenic
995379734 5:111518515-111518537 TTGTGTTTTTAATAGAGGCATGG + Intergenic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
996135426 5:119836075-119836097 CTGTGCATGTAAAAGAGGCAGGG - Intergenic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
999627930 5:153539971-153539993 CTGTATTTGTAGAATTGGAAGGG - Intronic
1000532607 5:162442583-162442605 CTGTGTTTGAAATAATGGAAGGG - Intergenic
1001015215 5:168134791-168134813 CTTTGTTTGGAAAAGTGGGTGGG - Intronic
1001831694 5:174794386-174794408 ATGTCTTTGTAAAAGTAGGAGGG + Intergenic
1003015777 6:2466499-2466521 CTGTGTTTTAAAAAGTAACAGGG - Intergenic
1005328525 6:24725711-24725733 TTGTATTTTTAAAAGAGGCAGGG - Intergenic
1005528156 6:26672978-26673000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005530916 6:26704978-26705000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005539880 6:26796668-26796690 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1005542639 6:26828661-26828683 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1005634144 6:27737450-27737472 CTGTGTTTGAAAAATTTTCATGG - Intergenic
1006081216 6:31568041-31568063 CTGATGTTGTAAGAGTGGCAGGG - Intergenic
1007256484 6:40532975-40532997 CTGTGGTTGTAAAAATGCAACGG + Intronic
1009010697 6:57838796-57838818 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009013456 6:57870774-57870796 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009798564 6:68503199-68503221 CTGTTTTAGTGGAAGTGGCAGGG - Intergenic
1013016671 6:106166091-106166113 ATGTGTGTGTCAAAGAGGCAAGG + Intergenic
1013318741 6:108966291-108966313 CTGTGTTTTTAAAAGTTCCACGG - Intronic
1014125738 6:117774991-117775013 CTGAGTATGGAAAAGTGGCCAGG - Intergenic
1014583656 6:123170193-123170215 TTGTGTTTTAAATAGTGGCAAGG + Intergenic
1014653519 6:124070885-124070907 CTGTTTTTGTAACAGTGCCATGG - Intronic
1016087414 6:139931068-139931090 TTGTGTTTGTACACGAGGCAGGG + Intergenic
1016668330 6:146670746-146670768 CTGTGTTTAGAACAGTGACACGG + Intronic
1016742333 6:147541673-147541695 GTGTGTTTGTATATGTGGAAGGG - Intronic
1017729827 6:157305556-157305578 CTGTTTGTTTTAAAGTGGCAGGG + Intronic
1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG + Intronic
1019116468 6:169767707-169767729 CTGTGTGTGTATATGTGGCATGG - Intronic
1020490292 7:8774268-8774290 CTGTTTTTGTACAAGTGCCATGG + Intergenic
1021371528 7:19854558-19854580 CTCTGTTAGAAAAAGTGGCATGG - Intergenic
1021680259 7:23123383-23123405 CTGTGTTTGAAAAACTGTCAGGG + Intronic
1022086222 7:27070156-27070178 TTGTGTTTTTAGTAGTGGCAGGG - Intergenic
1023792465 7:43763821-43763843 CTGAGTTTGTAAAAGAGAAACGG - Intronic
1026453207 7:70547425-70547447 TTGTGTTTGTAATAGAGACAGGG + Intronic
1026644093 7:72152920-72152942 GTGTGTTTGTCCAACTGGCAAGG - Intronic
1026854555 7:73744389-73744411 ATGTGATTCTTAAAGTGGCAGGG + Intergenic
1027156231 7:75770240-75770262 CTGTGTTTTTAATAGAGACAAGG + Intronic
1031554037 7:123149477-123149499 CTGTGATGGTACAAGTGGCAGGG + Intronic
1032320940 7:130886155-130886177 CAGTATTTGAAAAAGTGGCTAGG + Intergenic
1032749770 7:134827092-134827114 TTGTGGTTGTAAAAGTTGAATGG - Intronic
1034471920 7:151259423-151259445 GTGTGTTTCTAAAGGAGGCAGGG + Intronic
1035675503 8:1452869-1452891 CTGTTTTTGTAAAAGGGGGGTGG + Intergenic
1035829186 8:2676163-2676185 CTGTGTTTTTAAAGTTGGCCTGG + Intergenic
1036731730 8:11271524-11271546 CTGTGCTTTAACAAGTGGCATGG - Intergenic
1037043043 8:14261200-14261222 CTGTATTAGCAAAAGAGGCAAGG - Intronic
1037443668 8:18943191-18943213 CTGTGGTTGCAAAAGTGGTGTGG - Intronic
1040619736 8:49078309-49078331 CTGTGTGTGCAAATGTGGGAGGG - Intergenic
1042113963 8:65411493-65411515 CAGTGTTTAGAACAGTGGCATGG + Intergenic
1042440155 8:68816482-68816504 CTGTGATTCTATAAGTGGTAAGG - Intronic
1042762640 8:72287318-72287340 CTGTTATTCTAAAAGTGGCCAGG - Intergenic
1047422943 8:124722234-124722256 CTGTGTTTGAAGAAGTGGATGGG - Intronic
1048118824 8:131555840-131555862 CTATGATTGTAAAAATGGGAAGG + Intergenic
1049600151 8:143503870-143503892 CTGGGTTTGTAATAGGGGCTGGG - Intronic
1049921071 9:364867-364889 GTGTGTGTGTGAAAGTGGAATGG + Intronic
1051599261 9:18855950-18855972 CTGTGCATGTAAGAGTGCCATGG - Intronic
1056246646 9:84702021-84702043 CTGTATTTAAAAAAATGGCAAGG + Intronic
1056704316 9:88939264-88939286 TTGTGTTTGTAAGAGTGATATGG + Intergenic
1058913043 9:109538743-109538765 CTGTTTTTCTAGAACTGGCAAGG - Intergenic
1059936281 9:119314330-119314352 TTGTGTTTACAAAATTGGCATGG - Intronic
1186833376 X:13413255-13413277 GCGTGTTTGACAAAGTGGCAAGG + Intergenic
1187741348 X:22359218-22359240 CTTGGTTCGTAGAAGTGGCAGGG - Intergenic
1188703707 X:33299764-33299786 CTGTAATTGTAAAAATGGCATGG - Intronic
1191975195 X:66863878-66863900 CAGTGTTTGTGAAAGTGACCTGG - Intergenic
1192781861 X:74302646-74302668 TTGTATTTTTAATAGTGGCAGGG + Intergenic
1194888497 X:99348559-99348581 CTGTCTGGGTATAAGTGGCAAGG + Intergenic
1195271853 X:103239959-103239981 CTATGTATGTCAGAGTGGCAGGG + Intergenic
1196686488 X:118514666-118514688 ATGTGTTTGAAAAAGTGTGATGG - Intronic
1198086071 X:133283734-133283756 CTGTTTTGGTAATAGTGTCATGG - Intergenic
1198634899 X:138686322-138686344 CTGTGCTTATAAAAGTGAAATGG + Intronic
1198821392 X:140651950-140651972 CTGTCTTTTTGAAAGTGCCAGGG - Intergenic
1198973571 X:142309088-142309110 CTGTGTTTGTACAAATACCATGG - Intergenic
1199719756 X:150534474-150534496 CTCCATTTGTAAAAGTGGCTAGG + Intergenic
1202048235 Y:20755236-20755258 TTGTGTTTTTGAATGTGGCAGGG - Intergenic