ID: 999102755

View in Genome Browser
Species Human (GRCh38)
Location 5:149040361-149040383
Sequence CAGGACACACAGATGCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999102755_999102764 11 Left 999102755 5:149040361-149040383 CCCCCTAGCATCTGTGTGTCCTG 0: 1
1: 0
2: 0
3: 36
4: 311
Right 999102764 5:149040395-149040417 AGGCATTTGTAGCTGCCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 140
999102755_999102759 -9 Left 999102755 5:149040361-149040383 CCCCCTAGCATCTGTGTGTCCTG 0: 1
1: 0
2: 0
3: 36
4: 311
Right 999102759 5:149040375-149040397 TGTGTCCTGCCCACACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999102755 Original CRISPR CAGGACACACAGATGCTAGG GGG (reversed) Intronic
900990058 1:6094495-6094517 CTGGACACACACATGCTGCGCGG - Intronic
900996057 1:6124284-6124306 GAGGACACACAGAGGGTGGGAGG - Intronic
901290255 1:8118462-8118484 CAGGACACACAGAGTCGTGGTGG + Intergenic
901748535 1:11390941-11390963 CAGGATACACAGATGTTTGATGG - Intergenic
901775457 1:11557460-11557482 AAGGACACACAGCTGGCAGGTGG - Intergenic
903154695 1:21435846-21435868 CAGGTCACACAGTTGATGGGAGG - Intergenic
904090950 1:27944856-27944878 CAGGTCACACAGCTCCTAAGTGG + Intronic
904841631 1:33375579-33375601 AAGGGCAGGCAGATGCTAGGAGG + Exonic
905321967 1:37124218-37124240 AAGGACACACAGCTGGTAAGTGG + Intergenic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
906543146 1:46603570-46603592 CAGGACACACAGCTAAGAGGTGG + Intronic
907048550 1:51314761-51314783 CAGGTCACACAGCTGGTAGCTGG - Intronic
908112997 1:60915681-60915703 CAGTTCACACAGGTGGTAGGAGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911870254 1:103088247-103088269 CAAGTCACACAGATGCTAAGAGG - Intronic
912457304 1:109806701-109806723 CTGGTCACATAGCTGCTAGGCGG + Intergenic
913040003 1:115012682-115012704 CAGGACACACTGAAGCAAGCAGG - Intergenic
913255401 1:116948820-116948842 AAGGTCACACAGCTGATAGGTGG - Intronic
914704949 1:150162737-150162759 CAGGACACAGAGTTGAGAGGGGG + Intronic
914978703 1:152392606-152392628 AAAGCCACACAGATGGTAGGTGG + Intergenic
915130167 1:153690276-153690298 CAGCACACACAGGTCCTGGGAGG - Exonic
915605263 1:156946427-156946449 CAGGACACACAGGTGCTGGTGGG + Intronic
915942074 1:160124597-160124619 CATAACACACAGATGCAAGGAGG - Intronic
919982069 1:202648004-202648026 AAGGTCACACAGCTGCTAAGTGG - Intronic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
921008518 1:211117333-211117355 TAGGCCACCCAGATGCAAGGGGG - Intronic
922237321 1:223731817-223731839 CAGAACACAGAGCTGCTACGGGG - Intronic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922898179 1:229116674-229116696 CAGGACACACAGTGGCCTGGTGG + Intergenic
923102076 1:230824692-230824714 CTGGACACCCAGAAGCTAGCTGG - Intergenic
923501604 1:234569948-234569970 CAAGGCCCACAGATGGTAGGTGG + Intergenic
924375532 1:243403991-243404013 TAGGGCACACAGCTGCTAAGTGG + Intronic
1063187790 10:3666249-3666271 CAAAACACACAGTTGCTAAGTGG + Intergenic
1066501546 10:36000030-36000052 CAGGTCACACAGATGTGACGTGG + Intergenic
1067160773 10:43823026-43823048 AAGGTCACACAGTTGCTAAGTGG - Intergenic
1067816867 10:49485264-49485286 CAGGTCACGCAGCTGCTAAGTGG + Intronic
1068161080 10:53264864-53264886 CCAGACACCAAGATGCTAGGAGG + Intergenic
1068952291 10:62789697-62789719 CAGGACACACAGGAGCTGGAAGG - Intergenic
1069034728 10:63634566-63634588 CAGGACACTCGGAAGCAAGGGGG + Intergenic
1069065745 10:63940046-63940068 TAGGACACACAGCTGCTAAGTGG - Intergenic
1071330273 10:84551992-84552014 CAGGACACGCAGAAGCTCAGAGG + Intergenic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1075371813 10:121943352-121943374 AAGGCCACAAAGATGCTAAGTGG - Intergenic
1076384741 10:130048087-130048109 CAGGGCACCAAGATGATAGGGGG - Intergenic
1076647577 10:131963823-131963845 CAGGACACACCATTGTTAGGGGG - Intergenic
1078397422 11:10993371-10993393 CAGGAGGCACAGATCATAGGAGG + Intergenic
1078545644 11:12245272-12245294 CATGACACACAGAGCCTCGGTGG - Intronic
1079520583 11:21321710-21321732 CAGGCCACACAGCTGATAAGTGG + Intronic
1081190038 11:40092529-40092551 CAAGAGACACACATGATAGGAGG + Intergenic
1081224242 11:40501121-40501143 CAGGTCACACTGGTGCAAGGGGG + Intronic
1081533107 11:43977816-43977838 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1082766113 11:57169362-57169384 CAGGTCACACTGATGCAAGAGGG + Intergenic
1083252271 11:61476140-61476162 CAGGTCACACAGCTACTAAGGGG - Intronic
1083412011 11:62500398-62500420 CAGTTCACACAGGTGCTAGAAGG + Intronic
1083793097 11:64998746-64998768 CAGGCCCCTCAGAAGCTAGGAGG - Intergenic
1084558748 11:69890814-69890836 AATGACCCAGAGATGCTAGGAGG - Intergenic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1086280401 11:85179956-85179978 AAGGACACACAGCTAGTAGGTGG + Intronic
1088588098 11:111377725-111377747 AAGGGCACACAGATGCTTAGGGG + Intronic
1088820712 11:113454424-113454446 CAGGTCACACAGATCATAGAAGG + Intronic
1089342472 11:117767776-117767798 CAGGTCACACAGATTCCAAGTGG - Intronic
1089952007 11:122536485-122536507 CAGAACACACTGGTGCAAGGGGG - Intergenic
1090084271 11:123637431-123637453 CAAGGCACACAGATGGTAAGAGG - Intronic
1090763921 11:129860608-129860630 AAGACCACACAGATGCTAGGTGG + Intergenic
1091230884 11:133987321-133987343 CAGGATGCACAGATGCGTGGCGG - Intergenic
1093361864 12:18238554-18238576 CAGGACCCTAAGATGCTATGTGG - Intronic
1094300276 12:28956920-28956942 CAGGGCACATGGATGCTAAGTGG - Intergenic
1095956638 12:47810314-47810336 GAGGTCACACAGATGGTATGTGG + Intronic
1096070521 12:48773163-48773185 TAGGACATACAGCTGCTTGGTGG - Intronic
1096112536 12:49038007-49038029 CAGGGAGCACAGATGCCAGGCGG + Exonic
1096121375 12:49091492-49091514 CAGGACACTCAAAAGCTGGGAGG - Intronic
1096240565 12:49957755-49957777 AAGGACACTCAGGTGCCAGGAGG - Exonic
1097358271 12:58627291-58627313 AGGGCCACACAGATGCTAAGTGG + Intronic
1098206235 12:68113385-68113407 CAGAACACACAGCTGGTTGGTGG + Intergenic
1098310829 12:69147514-69147536 AAGGTCACACAGCTGCTTGGTGG + Intergenic
1098387689 12:69935991-69936013 CAGGCCACACAGATGGGAGCAGG - Intronic
1098995440 12:77114191-77114213 GATGACAAACAGATGCTATGGGG + Intergenic
1099559005 12:84149073-84149095 CAGGCCACACTGATGAGAGGAGG - Intergenic
1100401703 12:94236316-94236338 CAGCACACACAGGTGCTACACGG - Intronic
1102338907 12:112106585-112106607 GAGGTCACACAGATGGTAAGTGG - Intronic
1102355912 12:112235420-112235442 TAGGAAGCACAGATGCAAGGGGG + Intronic
1102774501 12:115506906-115506928 CAGATCACAGAGGTGCTAGGAGG - Intergenic
1102934775 12:116887236-116887258 CAGGAAACACAGCTGTTTGGAGG - Intergenic
1103210955 12:119166044-119166066 CAGGTCACACAGATAGTAAGTGG + Intergenic
1104391183 12:128391727-128391749 TAGGTCACACAGATGCCAAGTGG + Intronic
1105496887 13:20938325-20938347 CAGGGCACACAAATGATAAGTGG - Intergenic
1107019139 13:35733644-35733666 CAGGTCACAGAGATGCCTGGTGG + Intergenic
1109718412 13:66246478-66246500 CAGGTCACACTGATGCAAGAGGG - Intergenic
1111916391 13:94365042-94365064 TGGGACACACATCTGCTAGGAGG + Intronic
1112548133 13:100391573-100391595 CAGGACACAGGGAGGCTAGGCGG + Intronic
1112861609 13:103834152-103834174 CAGGTCACACTGATGCAAGAGGG - Intergenic
1114766127 14:25372786-25372808 CAAGTCACACAGTTGGTAGGTGG + Intergenic
1116119639 14:40705971-40705993 CAGGACACACTGAAGCAAGGGGG + Intergenic
1117372442 14:55090874-55090896 GAGGAGACACAGAGGGTAGGTGG + Intergenic
1118224759 14:63888351-63888373 CAGCACACACAGCTGCTGGCTGG - Intronic
1118383935 14:65239683-65239705 CAGGGCAGACAGAGGCCAGGAGG + Intergenic
1118484372 14:66199989-66200011 CAGGACAGAGAAGTGCTAGGAGG - Intergenic
1119167341 14:72505695-72505717 AAGGTCACACAGCTGGTAGGTGG - Intronic
1119874881 14:78050277-78050299 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1120230621 14:81836904-81836926 CAGGGCACACTGATGCCTGGTGG - Intergenic
1121425446 14:93847427-93847449 AAGGACACACAGCTGCTACGTGG + Intergenic
1121643596 14:95502404-95502426 CAGGACACACAGGCTGTAGGCGG - Intergenic
1121996444 14:98607008-98607030 CAGGCCAGACACATGCTGGGTGG + Intergenic
1122018663 14:98818702-98818724 TGGGACACACACAGGCTAGGAGG + Intergenic
1122294536 14:100697895-100697917 AAGGTCACACAGCTGCTGGGGGG + Intergenic
1122445750 14:101767263-101767285 CAGGTCGCATAGGTGCTAGGCGG + Intronic
1122875796 14:104664321-104664343 CTGGGCACACAGATGCCAGCAGG - Intergenic
1127261677 15:57331326-57331348 GAGGACGCACAGCTGTTAGGAGG + Intergenic
1128184201 15:65630485-65630507 CAGGACCCACAGAGGCAGGGGGG - Intronic
1128266723 15:66273271-66273293 AAGGACATAGAGATGATAGGGGG + Intergenic
1128336056 15:66786422-66786444 AAGGTCACACAGCTGCTAAGTGG - Intergenic
1132338881 15:101065737-101065759 CCGGGCACACAGCTGGTAGGTGG - Exonic
1132614574 16:833728-833750 CAAGTCACACAGCTGCCAGGAGG - Intergenic
1133242243 16:4421830-4421852 AAGGACACACAGCTGGTAAGTGG + Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134215999 16:12317335-12317357 AAGGACACACAGAAGCCAGGGGG - Intronic
1135208876 16:20507173-20507195 CAGGACACACTGATGCAAGAGGG + Intergenic
1135601328 16:23786231-23786253 CAGGTCACACAGCTGCTATAAGG + Intergenic
1137621944 16:49882020-49882042 CAGGCCACACAGCTGGCAGGTGG + Intergenic
1137676741 16:50307378-50307400 CAGGCCACACATATGACAGGTGG - Intronic
1137788995 16:51158655-51158677 CAGGTCACACTGCTGGTAGGAGG - Intergenic
1138752595 16:59441922-59441944 AAGGACACACAGCTGGTATGTGG + Intergenic
1139438803 16:66953504-66953526 CAGGACACAGATAGGCGAGGAGG - Intergenic
1141202548 16:81908966-81908988 GAGGAGACAGAGATGCTAGAAGG - Intronic
1141444668 16:84050176-84050198 GAGGATACCCAGATGCTGGGGGG - Intergenic
1141642133 16:85347492-85347514 CAGGACACACTCAGGCTCGGAGG - Intergenic
1141779883 16:86152378-86152400 CAGGAAACATAGATGCTGGGGGG + Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142103878 16:88291766-88291788 CAGGACACCCAGACGCAGGGAGG - Intergenic
1142174351 16:88638410-88638432 CAGGACACAGACATGCAAGGAGG - Intergenic
1142549060 17:726741-726763 CAGGTCACACAGCTTCCAGGTGG + Intergenic
1143346001 17:6249728-6249750 CAGGACACACAGATAATAAATGG + Intergenic
1143380638 17:6493968-6493990 CACGACACAGGGATGCTAGAGGG + Intronic
1143998279 17:11028053-11028075 CAGGTCACACAGATACCACGTGG + Intergenic
1146479901 17:33196852-33196874 CATGACACACAGATGGGAGTAGG + Intronic
1146890117 17:36501450-36501472 CAGGACACACAGGCGCAAGTGGG - Intronic
1146943144 17:36857736-36857758 CAAGGCACACAGCTGCTAAGTGG - Intergenic
1148774951 17:50090033-50090055 CTGGACAGACAGATGTTGGGAGG + Intronic
1148983462 17:51599602-51599624 CAGGACACACTGGTGGAAGGGGG - Intergenic
1149414326 17:56443173-56443195 AAGGCCACACAGATGATAAGAGG - Intronic
1150405000 17:64893957-64893979 CAGAACACAAAAATGATAGGAGG - Intronic
1150647323 17:66987188-66987210 GAGGTCACACAGCTGCTAAGTGG + Intronic
1152321878 17:79612321-79612343 CAGGACAGTCAGGTGCGAGGAGG - Intergenic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1154024635 18:10696018-10696040 CAGGAAACACAGTTGCATGGAGG + Intronic
1156677267 18:39543005-39543027 GAGGAAGCACAGATGTTAGGAGG + Intergenic
1156850757 18:41723179-41723201 CAGGTTACACAGATTCTAAGTGG + Intergenic
1157016808 18:43724961-43724983 GAGAACACACAGATACAAGGAGG + Intergenic
1157301044 18:46479516-46479538 AAGGTCACACAGATGGTAGGTGG - Intronic
1157477385 18:48031974-48031996 ATGGAAACACTGATGCTAGGTGG + Intronic
1157520737 18:48343591-48343613 AAGGTCACACAGCTGATAGGTGG - Intronic
1157548153 18:48562327-48562349 CAGGTCACACAGCTACTAAGTGG + Intronic
1157673205 18:49548480-49548502 AAGGAGACAGAGGTGCTAGGAGG + Intergenic
1158805573 18:60967887-60967909 CAGGACACAAAGCAGCTAAGAGG + Intergenic
1160010855 18:75106138-75106160 AAGGCCACGCAGATGCCAGGAGG - Intergenic
1160357646 18:78241880-78241902 AAGGACACACAGATGGGAGTGGG + Intergenic
1162057872 19:8075623-8075645 AAGGACACACAGCTTCGAGGCGG - Intronic
1163173847 19:15551064-15551086 CAGGACACACAGCTAGTAAGAGG + Intronic
1164666571 19:30042733-30042755 CAGGCCACACTGATGCCAAGAGG - Intergenic
1165114006 19:33518185-33518207 CAGGAGACAGAGGTGCAAGGTGG - Intronic
1166019023 19:40008140-40008162 AAGGTCACACAGCTGGTAGGTGG + Intronic
1166545724 19:43634076-43634098 CAGGTCACACAGATGGCAAGTGG - Intronic
1166558567 19:43717440-43717462 CAAGTCACAGAGATCCTAGGAGG + Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1168288244 19:55345031-55345053 CACCACACACAGACGCTGGGGGG + Intronic
1168411392 19:56142327-56142349 AAGGACACAGAGCTGGTAGGAGG + Intronic
925530775 2:4859837-4859859 CAGTTCACACAGATGATAAGTGG + Intergenic
925910972 2:8573531-8573553 CAGGACACACAGCTTCTGCGGGG - Intergenic
925944609 2:8849426-8849448 CAGCAGACACACAGGCTAGGAGG + Intergenic
926083240 2:10005541-10005563 CAGGACACACACATGGGAGGGGG - Intergenic
926142418 2:10375626-10375648 CAGGTCACACAGCTGCTAACAGG - Intronic
926473142 2:13286433-13286455 CAGAATACACAGTTGCTATGTGG - Intergenic
927136993 2:20104492-20104514 CAGGTCACACACCTGCTAGGTGG - Intergenic
928396969 2:30949991-30950013 CAGGTCACACATATTCTAGATGG - Intronic
928450233 2:31371980-31372002 CAGGCCACACAGTTGGTAAGTGG - Intronic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
931802647 2:65773552-65773574 CAGTACACACAGGGGCGAGGTGG + Intergenic
931951960 2:67374015-67374037 CAGGAATCAGAGATGCCAGGTGG - Intergenic
936994494 2:118398856-118398878 CAGGTCACACTGAGGCAAGGTGG - Intergenic
937302847 2:120853793-120853815 CACCCCACACAGATGCCAGGAGG - Intronic
937345096 2:121120582-121120604 TATGATACACTGATGCTAGGCGG + Intergenic
938645116 2:133322704-133322726 TAGGACACATAGAAGCTATGTGG + Intronic
939642624 2:144659560-144659582 CAGATCATACAGATGCTAAGGGG + Intergenic
942191957 2:173479093-173479115 CAGGACACACAGAGCCTGGTAGG - Intergenic
946365374 2:219245703-219245725 CAGGACACACAGCGGCTACCGGG - Intronic
947133856 2:226956911-226956933 GAGGACACACATAAGCTAGAAGG - Intronic
947831980 2:233147922-233147944 CAGGTCACACAGCTGCTAAGTGG - Intronic
948055475 2:235006913-235006935 AAGGACACACAGATGCGGCGTGG - Intronic
948305431 2:236943884-236943906 CAGGACACACAGCTGGTTTGAGG + Intergenic
948337420 2:237221448-237221470 CAGGTCACACAGCTGGTAGCGGG + Intergenic
1169592908 20:7164466-7164488 CAGGTCACACTGATGCAAGAAGG - Intergenic
1171721242 20:28565195-28565217 AAGGACACACAGATACAAGGAGG - Intergenic
1171756826 20:29118368-29118390 AAGGACACACAGATACAAGGAGG + Intergenic
1171862874 20:30417631-30417653 AAGGACACACAGATACAAGGAGG + Intergenic
1172610028 20:36243829-36243851 AAGGTCACACAGCTGCTAAGTGG + Intronic
1172853272 20:37981973-37981995 CAGGAAACACAGGTGAGAGGAGG + Intergenic
1173646308 20:44635230-44635252 CAGCTCTCAGAGATGCTAGGGGG - Intronic
1174294628 20:49536883-49536905 GAAAACACACAGATGCTGGGAGG + Intronic
1174375107 20:50121382-50121404 AAGGTCACACAGCTGGTAGGTGG - Intronic
1174419234 20:50388865-50388887 CAAGACACACAGATGATTGAAGG - Intergenic
1175143631 20:56879644-56879666 CAAGACTCAGAGAGGCTAGGTGG + Intergenic
1175476042 20:59275256-59275278 CAAGGCACACAGCTGCCAGGAGG + Intergenic
1175892118 20:62320563-62320585 CAGGACGCACGGCGGCTAGGCGG - Exonic
1177733236 21:25056407-25056429 CAGGACACAAAGATACAAAGTGG + Intergenic
1178724028 21:35035454-35035476 CAGGCCACACGGCTTCTAGGAGG - Intronic
1179123325 21:38568968-38568990 CAGGACACAGGGGTGATAGGGGG + Intronic
1179770293 21:43610265-43610287 AAAGACAGACAGATGATAGGTGG + Intronic
1181996126 22:26884131-26884153 AAGGGCACACAGATAGTAGGTGG - Intergenic
1182086166 22:27562735-27562757 CAGGTCACACAGCTGATACGTGG + Intergenic
1182086715 22:27565921-27565943 CAAGTCACACAGATGTTAGTGGG - Intergenic
1182451597 22:30425128-30425150 CAGAACACACAGCTGCTAAGTGG - Exonic
1183293655 22:37017887-37017909 CTGCTCACACAGATGCTAGGTGG + Intronic
1183439648 22:37815979-37816001 AAGGAGACACAGAAGCTAGAGGG - Intronic
1183716559 22:39536619-39536641 CAGGTCACACATCTGCTAAGCGG - Intergenic
1184500766 22:44870272-44870294 CAGGAAACAGAGATGCATGGCGG + Intergenic
1184512992 22:44943883-44943905 CATGAGACCCAGTTGCTAGGAGG - Intronic
1185047083 22:48533981-48534003 CAGGAAATGCAGATGCTAAGGGG - Intronic
950427564 3:12932726-12932748 CAGGTCCCACAGCTGATAGGTGG + Intronic
950755406 3:15166994-15167016 CAGGAAACTGAGATGCAAGGGGG - Intergenic
951046115 3:18040579-18040601 CAGGCCACACAGCTTCTTGGAGG + Intronic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
952125971 3:30301144-30301166 CAGGACACAGAGATAATAGCAGG + Intergenic
953451112 3:43007137-43007159 CAGGACATACTGTTGCTAGTGGG + Intronic
953908572 3:46881104-46881126 CAGGACACACAACTGGTAAGCGG + Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
961196232 3:125003743-125003765 CTGGACACACTGTTGCCAGGAGG + Intronic
961555544 3:127694545-127694567 CAGGGCACACAGGTGCTGGCAGG - Intronic
964384159 3:156129549-156129571 CAGGTCACACAGATTGTAAGGGG - Intronic
967916965 3:194585928-194585950 CAAGCCACACAGATGATAGGCGG + Intergenic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969317025 4:6388542-6388564 CAGCACACACAGATACAGGGAGG + Intronic
969351695 4:6601822-6601844 GAGGTCACACAGCTGCGAGGTGG + Intronic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
972886111 4:43490987-43491009 AAGGACACACAGCTGCTAAGTGG - Intergenic
972982047 4:44716128-44716150 CAGGTCATACAGATACTAAGTGG + Intronic
973343704 4:49031667-49031689 CAGGAGGCAGAGATGATAGGTGG + Intronic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
974905617 4:68052684-68052706 AAGGACACACAGCTCCTATGAGG + Intergenic
975350374 4:73339333-73339355 CAGGTCACACTGATGCAAGAGGG + Intergenic
976259823 4:83135172-83135194 CAGGTCACACTGATGCAAGACGG + Intronic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
979632986 4:122923877-122923899 CAGGCTACACAGGTGCTAAGTGG + Intronic
979815013 4:125089525-125089547 CAGGTAACACAGATGATATGAGG + Intergenic
981210516 4:142098486-142098508 GAAGAAACAAAGATGCTAGGAGG + Intronic
982921604 4:161280678-161280700 CAGGACACAGAGATGTCAGATGG - Intergenic
983034642 4:162848588-162848610 CTGGACACAAAGATGCTATGGGG - Intergenic
985044961 4:185931374-185931396 AAGGACACACAGATTTTATGAGG + Intronic
985370569 4:189281575-189281597 AAGGACACACAGATACAAGGAGG - Intergenic
985371788 4:189292704-189292726 CAGGCCACACTGATGCAAGAGGG - Intergenic
989218640 5:38930459-38930481 CAGGACAGCCAGATGTGAGGTGG + Intronic
990672607 5:58149919-58149941 CAGTTCACACAGATTCCAGGAGG - Intergenic
991127719 5:63086413-63086435 CAGGTCACACAGCTAGTAGGTGG - Intergenic
991603990 5:68381944-68381966 CAGCCCATACAAATGCTAGGTGG - Intergenic
991609940 5:68439684-68439706 CAGCACACACATATGGTAGCTGG - Intergenic
993353792 5:86881503-86881525 CCAGACACTCAGATGCTGGGAGG - Intergenic
994687182 5:102969961-102969983 GAGGAAGCACAGATGATAGGTGG + Intronic
997259023 5:132451451-132451473 GAGGACAAACACATGCTTGGTGG - Intronic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999456755 5:151723294-151723316 CAGGGCACACAGTAGCTATGGGG - Intergenic
999567522 5:152881480-152881502 AAGGACACAGAGATTCTGGGAGG + Intergenic
1000537500 5:162497058-162497080 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1001299932 5:170526133-170526155 CAGGTCACACAAGTGCAAGGTGG - Intronic
1001528751 5:172447620-172447642 GAGGTCACACAGTTGGTAGGTGG + Intronic
1001685881 5:173594772-173594794 AAGAACACACAGCTGGTAGGGGG + Intergenic
1002204502 5:177553764-177553786 CAGGAGACACAGCTGCTGAGGGG + Intronic
1002585467 5:180244209-180244231 AATGGCACACAGATGCTGGGTGG - Intronic
1002774798 6:319558-319580 TAGGACTCACAGATGCCCGGGGG + Intronic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004533357 6:16475592-16475614 AAGGACACACAGCTACTGGGTGG + Intronic
1004784394 6:18950449-18950471 GAGAACACATGGATGCTAGGAGG + Intergenic
1008278297 6:49566139-49566161 CTGGACACAGACATGCTGGGGGG + Intergenic
1008937349 6:57006103-57006125 AAGGTTACACAGATACTAGGTGG - Intronic
1010473587 6:76260409-76260431 GAGAACACACAAATACTAGGAGG - Intergenic
1010498560 6:76566729-76566751 CAGGGCACACTGCTGCAAGGGGG + Intergenic
1011712359 6:90067476-90067498 CAGGAGACACTCATGCAAGGAGG + Intronic
1015816160 6:137212853-137212875 CAAGACAGACAGGTGGTAGGAGG + Intronic
1017058488 6:150459087-150459109 CAGGTCACACAGCTCCCAGGTGG + Intergenic
1018766183 6:166934735-166934757 CACGACACACATATGCTTTGTGG - Intronic
1018857626 6:167685857-167685879 CATCACACACAGATGCCAGGAGG - Intergenic
1021783018 7:24124638-24124660 CTGCACACACACATCCTAGGGGG - Intergenic
1022394200 7:29971176-29971198 CAGGTCACACAGCTAGTAGGTGG - Intronic
1022487464 7:30790839-30790861 CAGGTGACACAGTTGGTAGGTGG + Intronic
1022805474 7:33816984-33817006 CAAGTCACACAGATGGAAGGTGG + Intergenic
1023102059 7:36727648-36727670 CAGGGCACACAGCTACTAGGAGG - Intergenic
1026361374 7:69603838-69603860 CAGGACACACTGATGGTAGTAGG - Intronic
1026532642 7:71212680-71212702 CAGGTCACACTGATGCCAAGAGG - Intronic
1028143961 7:87301081-87301103 GAGAACACACATATGCTAGGAGG + Intergenic
1031713264 7:125075621-125075643 CAGGCCACACTGATGCAAAGGGG - Intergenic
1032451935 7:132039122-132039144 CAGGTCACACAGCTAGTAGGTGG + Intergenic
1033217589 7:139504709-139504731 CAGGACACACAGCTGCTGCTTGG + Intergenic
1033807895 7:144975493-144975515 GAGGATACAGAGATGCTTGGGGG + Intergenic
1033904009 7:146178906-146178928 CAAGTCACAGAGCTGCTAGGTGG - Intronic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035181601 7:157093298-157093320 CACGAGATTCAGATGCTAGGAGG + Intergenic
1035936001 8:3840308-3840330 CAGGACAGCGAGATGCTAGTTGG - Intronic
1036973433 8:13381399-13381421 CAGGACACACAGATCACTGGAGG - Intronic
1037071222 8:14651979-14652001 CAGGAAACACAGCTGGTAGTAGG - Intronic
1037436017 8:18864262-18864284 AAGGTCACACAGATGGTAAGTGG - Intronic
1037695008 8:21215907-21215929 CAGGACCCACAGATCTTAGAAGG + Intergenic
1041782625 8:61594403-61594425 CAGGAGACACTGATGCAAGCTGG - Intronic
1041858911 8:62488879-62488901 AAGGATACACAGGTGCTAAGTGG - Intronic
1043356629 8:79420786-79420808 CAGGACTGGCAGATGATAGGTGG + Intergenic
1043380015 8:79692508-79692530 CAAGACACACAGCTGCTGAGAGG + Intergenic
1043485321 8:80693464-80693486 CAGGAAACAAACAAGCTAGGAGG + Intronic
1044804235 8:95988496-95988518 AAAGACACACAGCTGGTAGGTGG + Intergenic
1046171759 8:110517348-110517370 AAGAACACACAGATGGTAAGTGG - Intergenic
1046884118 8:119343916-119343938 AAGGACAGAGAGATGGTAGGGGG - Intergenic
1047307499 8:123664789-123664811 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1048464754 8:134656120-134656142 CAGGACTCACACAGGCTGGGTGG + Intronic
1048800219 8:138188031-138188053 GAGGACACTCACCTGCTAGGAGG + Intronic
1049405564 8:142450485-142450507 CAGCACACACAGACGCTGGCGGG + Intronic
1050666762 9:7946766-7946788 CAGCAAACACAAATGCTAGTTGG - Intergenic
1051707149 9:19892795-19892817 AAGGTCACACAGATGGTAAGTGG + Intergenic
1052170973 9:25396121-25396143 CAGGACACAGAGGTGGTAAGTGG - Intergenic
1057423718 9:94931826-94931848 TAAGACACACAGAAGCCAGGAGG - Intronic
1057500711 9:95594943-95594965 CAGGGCACACAGCTTCTATGGGG + Intergenic
1057855433 9:98597534-98597556 CAGGACACACAGACAGCAGGAGG + Intronic
1058739630 9:107930236-107930258 AAGGACACACAGTTGTTTGGGGG + Intergenic
1059051174 9:110927025-110927047 CAGGTGACTCAGATGCAAGGTGG + Intronic
1059301721 9:113319031-113319053 CAGGGCCCACAGATGCCAAGAGG - Intronic
1059309836 9:113380713-113380735 CAGAGCCCACAGATGTTAGGTGG - Intergenic
1059761889 9:117345530-117345552 AAGGTCACACAGCTGATAGGTGG + Intronic
1059798805 9:117728925-117728947 CAGGTCACACAGCTTCTATGTGG - Intergenic
1060188804 9:121579464-121579486 GAGGACACACAGATGTGAGGAGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060720348 9:125972392-125972414 AAGGACACACAGCTGACAGGAGG - Intergenic
1061701455 9:132419333-132419355 GAGGACACACCGCTGCCAGGTGG + Intronic
1062190370 9:135244942-135244964 CAGAACACACAGAGGCTCTGGGG + Intergenic
1185813318 X:3130638-3130660 GAGGACACAGAGAAGCTAAGGGG - Intergenic
1186633181 X:11373212-11373234 CAGGATACACAGATGTTAGTAGG + Intronic
1186657465 X:11630482-11630504 CAGGTCAAAAAGATGCTATGAGG + Intronic
1186738366 X:12490688-12490710 AAGCTCACACAGATGCTATGAGG + Intronic
1186780761 X:12909766-12909788 AAGGTCACTCAGATGGTAGGTGG - Intronic
1187031445 X:15492620-15492642 CAGGTCACACAGCTGATATGTGG - Intronic
1188624383 X:32265658-32265680 CAGGTCACGCTGATGCAAGGTGG - Intronic
1190338289 X:49276405-49276427 CAGGTCACACAGCTGATAGGTGG + Intronic
1190387662 X:49898422-49898444 CAGGACATGCTGATGCAAGGGGG - Intergenic
1190485022 X:50915470-50915492 AAGGACACACAGCTGGTATGTGG - Intronic
1192202031 X:69072582-69072604 CAGGACACACAAAGGCTGGCTGG + Intergenic
1192260220 X:69501714-69501736 CAGGAAAGACAGTTCCTAGGTGG + Intergenic
1193061545 X:77213445-77213467 CAGCACACACAGTTTCTAGCAGG - Intergenic
1195598572 X:106720722-106720744 AAGGTCACACAGCTGGTAGGTGG - Intronic
1196938631 X:120753945-120753967 CAGCCCACACAGGTGCGAGGTGG - Intergenic
1197899962 X:131360088-131360110 AAGGTCACACAGATGATAAGTGG + Intronic
1198385156 X:136122245-136122267 CAGGAGTCACAGATGCAAAGGGG - Intergenic
1199780126 X:151050890-151050912 CAGGTCACACAGCAGCTAAGTGG - Intergenic
1201268279 Y:12229898-12229920 GAGGACACAGAGAAGCTAAGGGG + Intergenic