ID: 999104223

View in Genome Browser
Species Human (GRCh38)
Location 5:149055458-149055480
Sequence TGTGTAGTTGTGTTCCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1313
Summary {0: 1, 1: 0, 2: 7, 3: 145, 4: 1160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999104223_999104225 28 Left 999104223 5:149055458-149055480 CCACAATGGAACACAACTACACA 0: 1
1: 0
2: 7
3: 145
4: 1160
Right 999104225 5:149055509-149055531 GATAAAGCCAAGTGTTTGTGAGG 0: 1
1: 1
2: 6
3: 43
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999104223 Original CRISPR TGTGTAGTTGTGTTCCATTG TGG (reversed) Intronic