ID: 999104225 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:149055509-149055531 |
Sequence | GATAAAGCCAAGTGTTTGTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 446 | |||
Summary | {0: 1, 1: 1, 2: 6, 3: 43, 4: 395} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
999104223_999104225 | 28 | Left | 999104223 | 5:149055458-149055480 | CCACAATGGAACACAACTACACA | 0: 1 1: 0 2: 7 3: 145 4: 1160 |
||
Right | 999104225 | 5:149055509-149055531 | GATAAAGCCAAGTGTTTGTGAGG | 0: 1 1: 1 2: 6 3: 43 4: 395 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
999104225 | Original CRISPR | GATAAAGCCAAGTGTTTGTG AGG | Intronic | ||