ID: 999107433

View in Genome Browser
Species Human (GRCh38)
Location 5:149086188-149086210
Sequence AGGCTGTTATAGGTGTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999107433_999107436 -8 Left 999107433 5:149086188-149086210 CCTTTTCACACCTATAACAGCCT No data
Right 999107436 5:149086203-149086225 AACAGCCTATCATTGGAGTCAGG No data
999107433_999107439 6 Left 999107433 5:149086188-149086210 CCTTTTCACACCTATAACAGCCT No data
Right 999107439 5:149086217-149086239 GGAGTCAGGCTGCTTCAGAAGGG No data
999107433_999107438 5 Left 999107433 5:149086188-149086210 CCTTTTCACACCTATAACAGCCT No data
Right 999107438 5:149086216-149086238 TGGAGTCAGGCTGCTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999107433 Original CRISPR AGGCTGTTATAGGTGTGAAA AGG (reversed) Intergenic
No off target data available for this crispr