ID: 999115150

View in Genome Browser
Species Human (GRCh38)
Location 5:149156267-149156289
Sequence ACAGCTAATAAGGGTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999115150_999115155 22 Left 999115150 5:149156267-149156289 CCAGCTTGACCCTTATTAGCTGT 0: 1
1: 0
2: 0
3: 17
4: 192
Right 999115155 5:149156312-149156334 TTACCAGACCCCCAAACGTCAGG 0: 1
1: 0
2: 1
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999115150 Original CRISPR ACAGCTAATAAGGGTCAAGC TGG (reversed) Intronic
903440129 1:23381592-23381614 ACAGCTAATAATGGCAGAGCTGG - Intronic
904994645 1:34621765-34621787 ACAGCAAATTATGGTCATGCTGG - Intergenic
905058415 1:35118958-35118980 ACAACTAATAGGGGTGAAACTGG + Intergenic
905561085 1:38927905-38927927 ACAGCTAATAAGGGGAGGGCTGG + Intronic
905954804 1:41983566-41983588 ACAGCTAATAAAGGTGCAGCTGG + Intronic
910342860 1:86207973-86207995 ACAGATAATATGGATGAAGCTGG + Intergenic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
911710957 1:101072474-101072496 AAAGGTAATAATGGTAAAGCAGG - Intergenic
913201730 1:116500160-116500182 ACAGCCAATAAGGGGCAATACGG - Intergenic
915746879 1:158168027-158168049 ACAGCTAATCAGGAGTAAGCAGG + Intergenic
917736406 1:177924855-177924877 ACAGCTAGTAAGGATGGAGCTGG - Intronic
918943581 1:191031636-191031658 ACAGCTAACAAGGGACATGAAGG + Intergenic
921748647 1:218767029-218767051 ATGGCTAATAAGGGTTAAGAAGG - Intergenic
921901031 1:220451014-220451036 AGAGCTAAGAATGGTCAAGGAGG + Intergenic
1063480088 10:6367880-6367902 ACAGTTGAAAAAGGTCAAGCTGG + Intergenic
1069884712 10:71616339-71616361 ACAGCAATTAAGGGCCAGGCTGG - Intronic
1071101226 10:82040013-82040035 AAAGTTAATAAGGGTTAAGAAGG + Intronic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1074611748 10:115028360-115028382 AGAGGTAATAAGGGCCAGGCAGG - Intergenic
1076198254 10:128536381-128536403 ACAGCTACTAAGTGACAAGTGGG + Intergenic
1076456855 10:130606079-130606101 ACAGCTGACAAGGGTCCCGCTGG - Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1081032624 11:38104601-38104623 ACAGCTAATAAAGGTAAATATGG - Intergenic
1081269840 11:41069698-41069720 ACAGCTAACAAGGGACATGCAGG + Intronic
1085833875 11:79931583-79931605 ACAGCTAATAAAGGGAGAGCTGG + Intergenic
1088760398 11:112923964-112923986 ACAGCTACTAAGAGACAAACAGG + Intergenic
1090944063 11:131413989-131414011 ATAGCTAGTTAGGGTCAAGCTGG - Intronic
1094153407 12:27311780-27311802 ACACCAAATAATGATCAAGCTGG + Intronic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1097685327 12:62685474-62685496 ACAGTTAATAAGTAGCAAGCTGG - Intronic
1098109751 12:67109788-67109810 ACAGCTAATCTTGGTTAAGCTGG - Intergenic
1098892611 12:76024688-76024710 ACAGCTAATAATTGTGAAACTGG + Intergenic
1101914067 12:108882846-108882868 ACATATAAAAATGGTCAAGCGGG + Intronic
1102468575 12:113145501-113145523 AAAGCTATTAAGAGTAAAGCTGG - Intergenic
1103063656 12:117878868-117878890 ACAGCTATTTACGGTCACGCTGG + Intronic
1103140362 12:118542701-118542723 ACATCTAATAAGTGACAAGGTGG + Intergenic
1105955968 13:25282904-25282926 ACACTTAAAAAGGGACAAGCAGG - Intronic
1106085898 13:26541339-26541361 ACAGCTATTAAGTGGCAGGCTGG - Intergenic
1107070206 13:36260169-36260191 GCAGCTAATAATGGTAGAGCTGG + Intronic
1107409244 13:40143294-40143316 GAAGCTAATAAGGTTCATGCTGG - Intergenic
1108084269 13:46768634-46768656 ACTGCTAATAAGGTGCAATCTGG - Intergenic
1108674195 13:52722118-52722140 ACAGCTCATAAGGAACCAGCTGG + Intronic
1110960315 13:81613875-81613897 ACAGAAAATAAGGGTCAACGAGG - Intergenic
1112609419 13:100941345-100941367 ACAGCTAATCAGGGTGCAGCAGG + Intergenic
1113521591 13:110945935-110945957 ACAGCTCATAGGGGCCAAGTTGG + Intergenic
1115410341 14:33067074-33067096 ACAGCTAATGAGGTGCAATCTGG + Intronic
1115564494 14:34613464-34613486 ACACCTAATAAGAATCAACCTGG + Intronic
1115928448 14:38463765-38463787 ACAGCTAACAAGGGACATGAAGG - Intergenic
1116017881 14:39428993-39429015 ACAACTAATAAGGATAAAGAAGG - Intronic
1117659408 14:57988076-57988098 ACAGCTAAATATGGTAAAGCTGG + Intergenic
1118298180 14:64589730-64589752 ACAGCTACTCAGGCTAAAGCAGG - Intergenic
1118985002 14:70746579-70746601 ACAGTTAATGATGGTGAAGCTGG - Intronic
1121437819 14:93930517-93930539 ACAACTAAGAAGGGTGCAGCAGG + Intergenic
1122559070 14:102598292-102598314 AAACCTAAATAGGGTCAAGCTGG - Intronic
1125253370 15:37732510-37732532 ACAGCTACTAAGTGACAAACAGG + Intergenic
1126197871 15:45952039-45952061 ACAGCTAAAATTGGTCTAGCAGG + Intergenic
1128192915 15:65720733-65720755 ACAGTTAACAAGGATGAAGCTGG - Intronic
1130169171 15:81494165-81494187 ACAGCTGATAAGAGTGGAGCTGG + Intergenic
1130625741 15:85512596-85512618 AAAGCTAGAAGGGGTCAAGCGGG - Intronic
1134535969 16:15027365-15027387 ACAGCTCCTAAGGCTCCAGCGGG + Intronic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1135737722 16:24945821-24945843 AAAGCTAATAAGGGTTAATAAGG + Intronic
1135750125 16:25051513-25051535 CCAGCTTATAAGGATCAAGCTGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1139860088 16:70013422-70013444 ACAGCTCCTAAGGCTCCAGCGGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1141502670 16:84454675-84454697 ACAGCTAATGTGGGTGAAGCTGG + Intronic
1146176893 17:30670880-30670902 ACAGCTAATAACTGTGAAGCCGG - Intergenic
1146350356 17:32086980-32087002 ACAGCTAATAACTGTGAAGCTGG - Intergenic
1146903481 17:36602643-36602665 ACAGGTAATGAGGGGCAAGAGGG + Exonic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147696487 17:42358704-42358726 ATAGCTAATAAATGTCAGGCAGG - Intronic
1148581022 17:48743811-48743833 TCAGCTTAGAAGGGTAAAGCAGG - Intergenic
1151151213 17:72088899-72088921 GCAACTAATCAGGGTAAAGCAGG + Intergenic
1152182650 17:78833591-78833613 ACAGTTACTAAGGGGCAAACTGG + Intronic
1153895161 18:9551971-9551993 CCATCTAGTCAGGGTCAAGCTGG - Intronic
1155752160 18:29438956-29438978 ACTGCTAAAAAGGGGCTAGCAGG - Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156501185 18:37559536-37559558 ACAGAGAATAAGGCTCAAGGTGG - Intronic
1156737171 18:40274366-40274388 ACAGCTAATATGGCTGTAGCTGG - Intergenic
1158316367 18:56215051-56215073 ACAGCTAGAAAGGGAGAAGCTGG - Intergenic
1162079221 19:8208916-8208938 ACAGCGAACAGGGGTGAAGCCGG + Intronic
1162981925 19:14246030-14246052 ACAGCTAATAACTGTGAAGCCGG + Intergenic
1165158762 19:33803699-33803721 GCAGCTAACGGGGGTCAAGCAGG - Intronic
1167343845 19:48932966-48932988 ACAGCCAAGAAGGGGCAAGGAGG + Intergenic
1167388161 19:49176878-49176900 ACAGCAAGAAAGGGCCAAGCTGG - Intronic
1167870339 19:52363866-52363888 ACAGCTAATATGTGACAAGATGG - Intronic
925727167 2:6884310-6884332 CCATCTGATAAGGGTTAAGCAGG + Intronic
930572088 2:53099686-53099708 AATGCTTATAAGGGCCAAGCTGG - Intergenic
931979149 2:67676086-67676108 AGAGCTAATAATGATCAAGTAGG - Intergenic
933588973 2:84210632-84210654 TCAGCTAATGAGTGGCAAGCTGG - Intergenic
934178521 2:89598847-89598869 ACAGCTAAGAAGTGACAAGGTGG - Intergenic
934288816 2:91673132-91673154 ACAGCTAAGAAGTGACAAGGTGG - Intergenic
936030810 2:109068692-109068714 ACAGCTCATAATGGCCAACCTGG - Intergenic
936784344 2:116075428-116075450 ACAGCTAACAAGGGACATGAAGG - Intergenic
937916589 2:127102253-127102275 ACAGCTTGTAAGGGACCAGCTGG + Intronic
938422997 2:131158754-131158776 ACAGCTAATAAGGGAATATCTGG - Intronic
939013427 2:136873930-136873952 TCAGCAAACAAGTGTCAAGCTGG - Intronic
941877504 2:170449195-170449217 AGAGCTAATAAAGGGAAAGCTGG - Intronic
941973704 2:171380680-171380702 ACAGCTAACAAGGGGCATGAAGG + Intronic
945563138 2:211362997-211363019 ACAGCTAAGAAGGGACATGAAGG + Intergenic
948732140 2:239972778-239972800 ACAGCTAATAAGAGTTAAGGAGG - Intronic
1169498885 20:6140430-6140452 ATAGCTAAGAAGTGTCAGGCTGG + Intergenic
1171143004 20:22759197-22759219 AAAGCCAATGAGGGTCAGGCTGG + Intergenic
1172824653 20:37771020-37771042 ACAGCTAATAAGGGAAAGTCAGG - Intronic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174317727 20:49715367-49715389 ACAGCTAACAATGGAAAAGCTGG - Intergenic
1174732705 20:52933398-52933420 ACAGCCAAGAAGTGGCAAGCGGG + Intergenic
1177022609 21:15882102-15882124 ACAGCTAATAAGGGACGTGAAGG - Intergenic
1177248073 21:18556518-18556540 ACAGCTAACAAGGGACATGAAGG - Intergenic
1177787239 21:25684476-25684498 ACAGTTAAAAATGGTCAAGATGG + Intronic
1180690652 22:17712443-17712465 ACAGTTAATAAGGGACAAATGGG + Intronic
1183127871 22:35802646-35802668 ACAGCTAAAAGGGGCCAACCTGG + Intronic
1184579506 22:45405179-45405201 ACACATAATAAAGGTCAAGGTGG + Intronic
953306309 3:41833240-41833262 ACAGCTAACAAGGGACAGGAAGG - Intronic
953471250 3:43168782-43168804 ACAGCTAGGAAGGGGGAAGCTGG - Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
955692532 3:61604749-61604771 ACAGCTAATAGGGTTCTAGGGGG - Intronic
956350092 3:68325166-68325188 ACAACTAGTAAGGGACAAACAGG - Intronic
957388448 3:79529612-79529634 ACAGCTAATAAGTGACAAACAGG + Intronic
958534545 3:95382017-95382039 ACAGATAATAAAGATCAAGGAGG - Intergenic
959258995 3:104050990-104051012 ACAGCTAACAAGGGACATGAAGG + Intergenic
960362461 3:116730515-116730537 ACAGTAAATAAGGGTCAAATCGG - Intronic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
962692336 3:137911713-137911735 ACAGCTAATAAGGGATATGAAGG + Intergenic
963662912 3:148151191-148151213 ATAGCTAATAAGGGACAGTCAGG - Intergenic
966892515 3:184417592-184417614 ACAGCTAACAAGTGGCAAGTGGG + Intronic
969341643 4:6545702-6545724 CCAGCTAACAAGAGTCAGGCAGG - Intronic
969830737 4:9794556-9794578 ACAGCTAAGAAGTGACAAGGTGG + Intronic
970801753 4:19980096-19980118 AAAGCTAATATGGGTGAAGTGGG + Intergenic
971144850 4:23965475-23965497 ACAATGAATAAGGGTGAAGCTGG - Intergenic
975433389 4:74321466-74321488 ACAGCTAGTAGGAGTGAAGCTGG - Intergenic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
976220117 4:82749979-82750001 ACAGCTAATAAACGTAGAGCTGG - Intronic
979386346 4:120069348-120069370 ACAGCTTATAAGGATAAAGGAGG + Intergenic
981187418 4:141820114-141820136 ACAGCTAACAAGGGACATGAAGG + Intergenic
982127805 4:152199527-152199549 ACTGCTAGTAAGGGTGGAGCTGG - Intergenic
982372702 4:154651277-154651299 ACAGCTAACAAGGGACATGAAGG + Intronic
983985204 4:174051354-174051376 ACAGCTAACAAGGGGCATGAAGG + Intergenic
988110859 5:26817191-26817213 ACAGCTAACAAGGGACATGAAGG + Intergenic
988131492 5:27112452-27112474 ACAGCTAACAAGGGACATGTAGG + Intronic
989081984 5:37631979-37632001 ACAGTTAATAAGGATCAAAACGG + Intronic
990155770 5:52875710-52875732 ACAGCTAAAAAGGTGCAACCGGG - Intronic
990839529 5:60061363-60061385 ACAGCTAACAAGGGACATGAAGG + Intronic
992272828 5:75083421-75083443 ATAGCTAAAAAGGGGAAAGCAGG + Intronic
992363950 5:76072470-76072492 AGAGCTAACAAGTGTGAAGCTGG + Intergenic
993253741 5:85560463-85560485 ACAGCTAACAAGGGACATGAAGG + Intergenic
997108093 5:131044901-131044923 ACAGCTAACAAGGGACATGAAGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999273214 5:150310334-150310356 ACAGCTAGGAAGGGTGGAGCTGG - Intronic
999511907 5:152261029-152261051 ACAGCTAGTACGCGTCAAGATGG + Intergenic
999883387 5:155892136-155892158 GAAGCTTATAAGGATCAAGCAGG + Intronic
1005804109 6:29457909-29457931 ACAGCTACTAATGGTTAAGAAGG - Intronic
1008277051 6:49553964-49553986 AAAGCTAATGAAAGTCAAGCCGG + Intronic
1010412271 6:75573998-75574020 ACAGCTAACAAGGGACATGAAGG + Intergenic
1011854571 6:91673343-91673365 ACAGCTCATCAGGGATAAGCTGG - Intergenic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1014410992 6:121120547-121120569 ACAGCTATTAATGGTTAAGTTGG - Intronic
1017739711 6:157396021-157396043 CCAGCTATGAAGGGACAAGCAGG - Intronic
1019937454 7:4265715-4265737 CCAACTAGGAAGGGTCAAGCGGG + Exonic
1021520249 7:21532490-21532512 ACAGCTAACAAGGGACATGATGG - Intergenic
1022635055 7:32124137-32124159 ACAGCTAACAAGGGACATGGAGG + Intronic
1027659686 7:80974631-80974653 ACAGCTCATAAAGGCCAGGCAGG + Intergenic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1028523435 7:91757484-91757506 ACAGCTAACAAGGGACATGAAGG + Intronic
1028644554 7:93080814-93080836 ACAGTTAATAAGGGACATGAAGG + Intergenic
1029324332 7:99793065-99793087 AATGATAATAAGGGTTAAGCTGG - Intergenic
1030759767 7:113336126-113336148 ACAGCTAACAAGGGGCATGAAGG + Intergenic
1031697153 7:124872481-124872503 ACAGCTACTAAGTGACAAACAGG - Intronic
1031925183 7:127632156-127632178 CCAGCTAAGTAGGGTAAAGCAGG - Intergenic
1033972906 7:147065122-147065144 ATAGCTAATAAGGGAAGAGCTGG - Intronic
1034613723 7:152396072-152396094 ACAGCTACTAAGTGTGAGGCTGG + Intronic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1038352344 8:26788708-26788730 TCAGCCAATAAGAGTGAAGCTGG + Intronic
1040488600 8:47898395-47898417 ACAGCTAATGAAGGACAACCTGG - Intronic
1040981160 8:53247463-53247485 ACACTTAATATGTGTCAAGCAGG - Intronic
1041337493 8:56803396-56803418 ACAGCTATTTAGGGACAAACAGG - Intergenic
1042551995 8:70002311-70002333 AAAGCTAATAAGATTTAAGCAGG - Intergenic
1042589230 8:70380083-70380105 ACAGGAAACAAGTGTCAAGCAGG + Intronic
1042949826 8:74189464-74189486 ACAGCTGATAAGGATCTAGTAGG - Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1046093653 8:109533041-109533063 AGAGCTACTAATGGTAAAGCTGG + Intergenic
1046890793 8:119418607-119418629 AGTGCTAATGAGGGTCAAGTGGG - Intronic
1047103534 8:121707599-121707621 ACAGCTACCAGCGGTCAAGCTGG - Intergenic
1047298780 8:123594803-123594825 ACAGCTAATAATGGTAGAACTGG - Intergenic
1048174348 8:132138389-132138411 ATAGCTAATAAGGGCTGAGCTGG + Intronic
1049717915 8:144102116-144102138 ACAGCTACTTAGGCTGAAGCAGG + Intronic
1057836887 9:98452449-98452471 ATAGCTAATCAGGGTCAAGTGGG - Intronic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1060297706 9:122354620-122354642 ACAGCTAGTAAGGGCCGAGGCGG + Intergenic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1060837892 9:126770963-126770985 ACAGCTAATAAATGTGGAGCTGG - Intergenic
1062043236 9:134413725-134413747 ACAGCCCCTCAGGGTCAAGCAGG - Intronic
1190095778 X:47479249-47479271 ATAGCTAGTAAGTGCCAAGCAGG + Intronic
1190390927 X:49930886-49930908 ACAGCTGATAAAGGTGTAGCTGG - Intronic
1190759487 X:53427777-53427799 ACAGCTCATAAGGGTAAGGTGGG + Intronic
1191091219 X:56624363-56624385 ACAGCTAAAAAGGGACATGAAGG + Intergenic
1191698271 X:64012420-64012442 ACAGCTAACAAGGGTAATGAAGG + Intergenic
1191726783 X:64290139-64290161 ACACCTAAAAATGGTCAAGAAGG + Intronic
1191869565 X:65734456-65734478 ACAGCTAAAAATGGTAGAGCTGG + Intronic
1194631696 X:96293202-96293224 ACAACTCATAAGGGACATGCAGG + Intergenic
1195685875 X:107585151-107585173 ACAGCTAACAAGGGACATGAAGG - Intronic
1197123888 X:122922099-122922121 ACAGCTAACAAGGGACACGAAGG - Intergenic
1197319515 X:125010309-125010331 ACAGCTAACAAGGGACATGAAGG + Intergenic
1197606603 X:128592793-128592815 ACAGCTAACAAGGGACATGGAGG - Intergenic
1197883936 X:131198354-131198376 ACAGCTAATATGAGATAAGCTGG + Intergenic