ID: 999115265

View in Genome Browser
Species Human (GRCh38)
Location 5:149157433-149157455
Sequence ATAAAGAATCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1038
Summary {0: 1, 1: 0, 2: 5, 3: 87, 4: 945}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999115265_999115271 25 Left 999115265 5:149157433-149157455 CCTTCCTCCTTCTGATTCTTTAT 0: 1
1: 0
2: 5
3: 87
4: 945
Right 999115271 5:149157481-149157503 ATACTAATGGACTGTCACCATGG 0: 1
1: 0
2: 0
3: 8
4: 94
999115265_999115269 12 Left 999115265 5:149157433-149157455 CCTTCCTCCTTCTGATTCTTTAT 0: 1
1: 0
2: 5
3: 87
4: 945
Right 999115269 5:149157468-149157490 CCATCTCCTTGTCATACTAATGG 0: 1
1: 0
2: 0
3: 4
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999115265 Original CRISPR ATAAAGAATCAGAAGGAGGA AGG (reversed) Intronic
900106757 1:984798-984820 ATAAAAAATGAAAAGGAGGCCGG - Intergenic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901472685 1:9468522-9468544 AGACAGAATCAGAACGAAGATGG + Intergenic
901793598 1:11667585-11667607 AAAAAAAATCAGATGGAGGGTGG - Intronic
901851772 1:12020250-12020272 AAAAAGAAAGTGAAGGAGGAAGG + Intronic
903107561 1:21096371-21096393 ACAAAGACTCACAAGGAGTAGGG + Intronic
903361747 1:22781332-22781354 AAAAAGAAGAAGAAGGATGAGGG + Intronic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
904032647 1:27542876-27542898 AGATAGGATCAGAGGGAGGATGG + Intronic
904130027 1:28268672-28268694 AAAAAGAAGCAAAAGAAGGAAGG + Intronic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904785720 1:32981264-32981286 AGAAAGTATAGGAAGGAGGAAGG - Intergenic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906313766 1:44772609-44772631 ATAAAGAATATGTAGGAGGCCGG - Intergenic
906336112 1:44932684-44932706 ATCAAGAATCAGAATGATGTTGG + Intronic
906511773 1:46414087-46414109 GGAAAGAAGCAGAAGAAGGAAGG - Intergenic
906976636 1:50581460-50581482 ATAAAGAAAGGGAAGAAGGAAGG - Intronic
907213916 1:52846119-52846141 TTAAAGAGTAAGAAGGAGAAAGG - Intronic
907474916 1:54699272-54699294 ATAAAGAGAGAGAAGGAGGGAGG - Intronic
907687460 1:56626036-56626058 ATAAAGAAGCAGAAGGACAAAGG + Intronic
908394166 1:63709955-63709977 AGAAAGAAACAGAAGGAAAATGG + Intergenic
908903671 1:68984244-68984266 AGAAAGAATGGGAAGAAGGATGG - Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909425558 1:75520558-75520580 AGAAAGAATGAGAAAGAGGAGGG + Intronic
909581280 1:77238515-77238537 GGAAAGAATAAGAAGGAGTAAGG + Intergenic
910045604 1:82910494-82910516 AATATGAATCAGAAGTAGGAAGG - Intergenic
910162140 1:84284799-84284821 AGAAAGAAGAAGAAGAAGGAGGG + Intergenic
910474834 1:87595651-87595673 AAAAAGAAAGAGAAAGAGGAGGG - Intergenic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
911042462 1:93601747-93601769 ATAAAGAAAAAGAAGAAGGAGGG + Intronic
911122740 1:94312327-94312349 AAAATGAAGAAGAAGGAGGAAGG - Intergenic
911284694 1:95975212-95975234 ATAAAGAATGAGGAGAAGGAGGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911721922 1:101200452-101200474 ATAGGGAATAAGAAGGAAGATGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
912063575 1:105706024-105706046 ATAAAAAATCAAATTGAGGACGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912558721 1:110535026-110535048 ATAAAGAATAATAATGATGATGG - Intergenic
912602864 1:110955889-110955911 ATACACAATGAGAAGGAGGCAGG + Intronic
913193092 1:116430247-116430269 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
913575166 1:120165151-120165173 ATATAGAATCAAAGGGTGGATGG - Intronic
914471162 1:147979352-147979374 AAAAAGGATAAGAAGAAGGAAGG - Intronic
914557470 1:148780795-148780817 ATATAGAATCAAAGGGTGGATGG - Intergenic
914615364 1:149349435-149349457 ATATAGAATCAAAGGGTGGATGG + Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
914922501 1:151856955-151856977 ATAAAGAGTCAGTAGGTGGCTGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915132820 1:153707701-153707723 AAAAAGAGACAGAAAGAGGAAGG + Intergenic
915381194 1:155442246-155442268 CTAAAGAATGAGTTGGAGGATGG - Intronic
916264323 1:162875433-162875455 ATAAGGAATCAAAAGGAGGATGG - Intergenic
916336255 1:163673991-163674013 ATCAGGAGTTAGAAGGAGGAGGG + Intergenic
916348758 1:163825062-163825084 ATAACGATTCCAAAGGAGGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918223230 1:182455283-182455305 ATAAAGAAATAGGAGGAGGCGGG + Intronic
918331413 1:183464322-183464344 AGAAAGAAAGAGAAGAAGGAAGG + Intergenic
918587950 1:186209472-186209494 ATAAAGAAAAAGAAGAAAGAAGG + Intergenic
918621907 1:186614909-186614931 AAAAAGAAACAGGAGGTGGAAGG + Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919563384 1:199152865-199152887 AGAAAGGAGGAGAAGGAGGAAGG + Intergenic
919594867 1:199548574-199548596 ATTAAAAATCAGAGGGATGAGGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919665211 1:200284963-200284985 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
919967329 1:202541139-202541161 ATACAGAGTAAGAAGAAGGACGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
920244189 1:204575757-204575779 TTAAACATTCAGTAGGAGGATGG + Intergenic
920437348 1:205956064-205956086 ATAAAGAAAGAGAAGAAAGAAGG - Intergenic
921043048 1:211452662-211452684 TTAAAGAACCAGAAGGTGGCAGG + Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
922175752 1:223195754-223195776 ATAAAGCACCAGAAACAGGATGG + Intergenic
922301785 1:224308087-224308109 CCAAAGATTCTGAAGGAGGATGG - Exonic
922356966 1:224785685-224785707 ACAAAGAACCAGGAGTAGGATGG - Intergenic
922661906 1:227437518-227437540 AGAAAGAAAGAGAAAGAGGAGGG + Intergenic
922679620 1:227581344-227581366 ATAAAGAAAGAAAAGAAGGAAGG + Intronic
922850149 1:228726083-228726105 ATAATAAAACATAAGGAGGAAGG - Intergenic
922924746 1:229339300-229339322 ATCAAGAATCATAACGAGGCAGG + Intronic
923066078 1:230518536-230518558 CTAAACCATCAAAAGGAGGAAGG - Intergenic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923504241 1:234591766-234591788 ATATAGAAACAGAAGGAGGCTGG - Intergenic
923629004 1:235637354-235637376 TTAAAGAATTAGAATGAGGCTGG + Intronic
923688883 1:236174286-236174308 ATAAAAATCAAGAAGGAGGAAGG + Intronic
924680571 1:246227631-246227653 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063121403 10:3107438-3107460 ATAATGACTCAGAAGTTGGACGG + Intronic
1063422993 10:5928502-5928524 CTAAAGAGTGAGAGGGAGGAAGG - Intronic
1063534152 10:6866612-6866634 AGAAAGGAAGAGAAGGAGGAAGG - Intergenic
1063621031 10:7649267-7649289 AGAAAGAATAAGAAGAAGAAGGG - Intronic
1063717739 10:8545289-8545311 AAAAAGAATAAGAAGAAGGAAGG - Intergenic
1063771494 10:9207796-9207818 ATTAAGAACCAGAAGGAGGCTGG - Intergenic
1064250373 10:13702003-13702025 ATAAAGAATCAGGAGAAGAAAGG + Intronic
1064769035 10:18704835-18704857 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
1064887842 10:20131854-20131876 ATAAAGAGTTAGCAGAAGGAAGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065775670 10:29117418-29117440 ATAAAAAATGAAAATGAGGAGGG + Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066588223 10:36961707-36961729 ATAAGGAATAAGAAGGGGGCAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067241023 10:44493694-44493716 AAAAAGAAAGAGAAGGATGAAGG - Intergenic
1067748786 10:48956513-48956535 AGCAAGAAGCAGAGGGAGGAGGG - Intronic
1067902326 10:50255232-50255254 AGAAAGAAGAAGAAGTAGGAAGG + Intergenic
1068098467 10:52521523-52521545 ATAAATATTCAGTAGGAGAAAGG - Intergenic
1068174006 10:53433494-53433516 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1068389706 10:56378827-56378849 ATAAAGTTTCAGAAAGAAGACGG - Intergenic
1068395726 10:56458727-56458749 AAAAAGAAGAAGTAGGAGGAGGG + Intergenic
1068441670 10:57063752-57063774 ATAAAGAATCGAAAGGAATATGG + Intergenic
1069067554 10:63959509-63959531 ATACAGATTCAGAAGGGGGAGGG + Intergenic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1069376805 10:67801121-67801143 ATAAAGAATTAGAATGTGGTGGG + Intronic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070490234 10:76969241-76969263 AGAAAGAGAGAGAAGGAGGAAGG + Intronic
1071521443 10:86333725-86333747 GAAAAGAATCATAAGGAAGAGGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1072085632 10:92076762-92076784 AGAAGGAAGAAGAAGGAGGAAGG + Intronic
1072723264 10:97793919-97793941 ATAAAGAAAAAGAGAGAGGAAGG - Intergenic
1073114051 10:101080982-101081004 ACAAGGAATGAGAAGGAAGAGGG + Intergenic
1073643839 10:105279233-105279255 AGAAAGAAAAAGAAGGAGGGAGG - Intergenic
1073744414 10:106449051-106449073 AAAAAAAATAAGAAGTAGGAAGG - Intergenic
1074188101 10:111114229-111114251 ATAAAGAATCACAGGAAGTATGG - Intergenic
1074953780 10:118367470-118367492 AGAAAGAAAAAGAAAGAGGAAGG + Intergenic
1075503473 10:123000169-123000191 ATCAAGAAACAGAAGGATGCCGG + Intronic
1075763016 10:124870956-124870978 AGAAAGAAAGAGAAGGAGGGCGG + Intergenic
1075821275 10:125314252-125314274 AGAAAAATTCAGAAGGTGGATGG + Intergenic
1076028138 10:127134256-127134278 ATAAACAGTCACAAGGAGGATGG - Intronic
1076283842 10:129274630-129274652 TTAAAGAGTCAAAAGGTGGAGGG - Intergenic
1076584518 10:131536397-131536419 AGAAAGAAACAGAAAGAGGGAGG + Intergenic
1076597010 10:131629949-131629971 AAAAAGAATCAGAACCATGAAGG - Intergenic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1078015257 11:7607959-7607981 ATAAAGAAAGAGAGGGAGGTAGG + Intronic
1078151133 11:8760460-8760482 ATAAAAAATTAGCAGGAGGTTGG + Intronic
1078168218 11:8909376-8909398 AAAAAGAAGAAGAAGGAAGAAGG + Intronic
1078213780 11:9293875-9293897 AAAAAGAATCAGAAGTAGCCAGG - Intronic
1078500749 11:11872577-11872599 ATAAAGACCCTGAAGGATGATGG + Intronic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079612953 11:22455929-22455951 AGAAAGAATGGGAAGGAAGAAGG - Intergenic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1080003851 11:27383041-27383063 AAAAATAATCAGAAGGACCAGGG + Intronic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080217772 11:29865254-29865276 AGATAGAATGAGAAGAAGGAAGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080928715 11:36785025-36785047 AGAAAGGAACAGAGGGAGGAAGG - Intergenic
1081309827 11:41556235-41556257 ACAAAGAATTAGAGGCAGGAAGG + Intergenic
1081896097 11:46588034-46588056 GAAAAGAAATAGAAGGAGGATGG + Intronic
1081950975 11:47042219-47042241 ATAAAGAAAGAGAGGAAGGAAGG + Intronic
1082758311 11:57100141-57100163 TTAATGAATCAGAAGCAGAAGGG - Intergenic
1082948180 11:58782404-58782426 AGAAAGAAATAGAAGGAGGATGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1085016913 11:73179705-73179727 TTAAAAAATCAGAGGGAGGCTGG - Intergenic
1085125744 11:74001041-74001063 ATAATGAATGATAAGCAGGAAGG - Exonic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086258036 11:84903349-84903371 TTAAAGAATTAGTAGGAGGTAGG - Intronic
1086259613 11:84923429-84923451 AAAAAGAAGAAGAAGAAGGAGGG + Intronic
1086459300 11:86989832-86989854 ATCAAGATTAAGAAGGAGAAAGG + Intergenic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1087505077 11:99010482-99010504 ATAAGGAATAAGAAGGAGTCGGG - Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1088059600 11:105630899-105630921 ATAAGAACTCAGAGGGAGGATGG - Intronic
1088174266 11:107033340-107033362 ATTAAAAATTTGAAGGAGGAGGG + Intergenic
1088384236 11:109235368-109235390 AGAAAGAAAGAGAAGAAGGAAGG - Intergenic
1088638128 11:111844298-111844320 ATAAAATCTCAGAAGGAGGCCGG - Intronic
1089590903 11:119540232-119540254 ATAATGAAACAGAAGAAAGATGG + Intergenic
1090161017 11:124495636-124495658 ATGAAGAATCACTTGGAGGAGGG - Intergenic
1090418838 11:126559428-126559450 GTAGAGAATCAGCTGGAGGAGGG - Intronic
1092017325 12:5170115-5170137 ATGCAGAATCGGAAGGCGGAGGG + Intergenic
1092037738 12:5353557-5353579 ATATAAAATGAGCAGGAGGAAGG + Intergenic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092696901 12:11182222-11182244 ATACAGAATCAAAAGGAACATGG + Intergenic
1093683805 12:22032957-22032979 AGAAAAAAACAGAAGGAGGAAGG + Intergenic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094354332 12:29562216-29562238 GTAATGGATCAGAAGGAGTACGG - Intronic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095740688 12:45603495-45603517 AAAAAGAAGAAGAAGGAAGAAGG - Intergenic
1095823663 12:46508638-46508660 ATAAAGAATGAGGAAGAGGATGG + Intergenic
1096366567 12:51033267-51033289 AAAAAAAAAAAGAAGGAGGAGGG - Intergenic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097133299 12:56830197-56830219 AGAAAGAAAAAGAAGAAGGAAGG - Intergenic
1097216126 12:57414532-57414554 ATTAAGAATGAGAAGCAGGCCGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097734021 12:63162355-63162377 CCAAAGAAACTGAAGGAGGAGGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1098854412 12:75636210-75636232 ATACAGGATGAGAAGGAGGTAGG - Intergenic
1099081066 12:78181843-78181865 ATACAGAAGGAGAAGGAGAAGGG + Intronic
1099278567 12:80611260-80611282 ATCAGGAGTCTGAAGGAGGATGG - Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100370157 12:93961772-93961794 TTAAAGATTCAGAAGGAGAAGGG + Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100619078 12:96254742-96254764 AAAAGGAATCCTAAGGAGGAAGG + Intronic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101084841 12:101225562-101225584 ATAAAGAATCAGTAGGATACAGG - Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101385222 12:104251392-104251414 ATAAGGAATCTGAGGAAGGAAGG - Intronic
1101392385 12:104313691-104313713 ATCAAGACTCAGAAGCAGCAAGG - Intronic
1101693010 12:107098347-107098369 AGAAAGAAAAAGAAGGGGGAGGG + Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101864979 12:108514206-108514228 ATAAAAAATCAGAAATAGGTCGG + Intergenic
1102398456 12:112608096-112608118 AAAAAGAAAGAGGAGGAGGAGGG - Intronic
1103211021 12:119166513-119166535 AAAAAGAATCAGAAAAAAGAAGG + Intergenic
1103894637 12:124264892-124264914 AGCAAGAATAAAAAGGAGGAAGG - Intronic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104668865 12:130667022-130667044 AGAAAGAAGAAGAGGGAGGAAGG + Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104881735 12:132076201-132076223 TGAAAGAATCAGACTGAGGATGG - Intronic
1104946831 12:132418639-132418661 AGAAAGAAAGAGAAGAAGGAAGG + Intergenic
1105800361 13:23897730-23897752 ATAAAGAAAAAGTAGGATGATGG + Intronic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1106062960 13:26312781-26312803 ATAAAGAATCAAAACGAGATAGG - Intronic
1106206768 13:27604421-27604443 GTAAAGAATAAGAATAAGGAGGG + Intronic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1106965774 13:35064924-35064946 AAAAAGAATCAGAGGCTGGATGG - Intronic
1107180345 13:37451204-37451226 ATAAAGCATCAGAAAGAATAAGG - Intergenic
1107781088 13:43902828-43902850 ATAAAAAATTTGGAGGAGGAAGG + Intergenic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108036922 13:46299723-46299745 ATAAACAATGAGAAGAAGTAAGG + Intergenic
1108038786 13:46320400-46320422 AAAAAGAAAAAGGAGGAGGAAGG + Intergenic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108567879 13:51719146-51719168 ATAAAGCATCCTAAGGAGGTTGG - Intronic
1109085791 13:57969906-57969928 AGAAAGAAACAGAAAGAGGTGGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109473053 13:62835979-62836001 AAAAAGAAAGAGAGGGAGGAAGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110077445 13:71265436-71265458 AAAAAAAATAAGAAGGAAGAAGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110304235 13:73966424-73966446 AAAAAGTATCTGAAAGAGGAAGG + Intronic
1110425083 13:75357863-75357885 AGAAATAAACAGAAGCAGGAGGG - Intronic
1110590091 13:77246478-77246500 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1110692636 13:78449332-78449354 AGAAAGAATGACTAGGAGGAAGG - Intergenic
1111337677 13:86844166-86844188 ATAAAAAATCAGAAGGACATAGG - Intergenic
1111837185 13:93402388-93402410 ATTAAGAATAAGAAGGTGAAAGG - Intronic
1111961274 13:94813267-94813289 ATAAAGAATCAGGTGGTGGAAGG + Intergenic
1112103600 13:96216941-96216963 ATCAGGAATCGGAAGGAGCAGGG - Intronic
1112111719 13:96307148-96307170 AGAAAGAGTAAGAAAGAGGAGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113057514 13:106285220-106285242 AGAAAGAATCAGAAGAAAGCTGG - Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113322201 13:109244984-109245006 TTAAAGAAGCAGAAGCATGATGG + Intergenic
1114189883 14:20432465-20432487 ATAAAAAAAAAAAAGGAGGAAGG + Intronic
1114586050 14:23814860-23814882 GCAAAGAATGACAAGGAGGAAGG + Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1114975320 14:28089551-28089573 GTAGAAAATCAGAAGGAGAAAGG + Intergenic
1115522076 14:34243023-34243045 ATAAGGGATGAGAAGGAGGCTGG - Intronic
1115747177 14:36449688-36449710 ATAATGAGGCTGAAGGAGGACGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116427342 14:44807100-44807122 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1117909310 14:60621419-60621441 AAAAAGAAACAGAAGAAGAAAGG + Intergenic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119144792 14:72302466-72302488 AAAAAGAATTAGAAGTGGGAAGG - Intronic
1119199834 14:72744149-72744171 ATAAAGAAACAGAAGAGGGATGG + Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1120030663 14:79637147-79637169 ACAATGAAACAGAAGTAGGAAGG - Intronic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120263691 14:82221308-82221330 ATAAAACATAAGAAGGAGGAAGG + Intergenic
1120343760 14:83256543-83256565 ATAAAAAATCAGAAGAAATATGG - Intergenic
1120662660 14:87269238-87269260 ATAAAGAAATGGAAGGTGGATGG + Intergenic
1120673988 14:87397482-87397504 CCACAGAATTAGAAGGAGGAAGG - Intergenic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1121200615 14:92114116-92114138 ATAAAGAATTACAAGGAGGCTGG - Intergenic
1121847462 14:97185755-97185777 AAAAAGAACCTGAAGGAAGATGG - Intergenic
1122832518 14:104406938-104406960 AGAAAGAATGAGAAGGCGGGGGG + Intergenic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1202876452 14_KI270722v1_random:6743-6765 ATAAAAAAAAAGAAGGAGGTTGG - Intergenic
1123875898 15:24623528-24623550 ATAAAGAAGAAGAAGAAGAAAGG - Intergenic
1124258043 15:28162030-28162052 ATAAAAAATTAGAAGAAGGCCGG + Intronic
1124991315 15:34676837-34676859 ACAAAGAATCTGAGGCAGGAAGG + Intergenic
1125255476 15:37758399-37758421 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1126138338 15:45414110-45414132 ATAGAGAGTGAGTAGGAGGAGGG + Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126620466 15:50634381-50634403 ATAAACAAACAGAAGAAGGAGGG - Exonic
1127792360 15:62409500-62409522 ATAAAAAATGAGAAGGGGAATGG - Intronic
1128000034 15:64182367-64182389 ATAAAGATTCAGCTGGAGGCCGG - Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128095733 15:64953538-64953560 AGAAAGAAGGAGAAGGAAGAAGG - Intronic
1128151537 15:65366406-65366428 ATAAAGAAAGAGAAGGAGGGAGG + Intronic
1128156297 15:65393980-65394002 ATAAAAAGTTAGGAGGAGGAAGG - Intronic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1130127399 15:81105252-81105274 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1131110165 15:89759952-89759974 ATAAAGAAGAAGAAGAAAGATGG + Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132075399 15:98815837-98815859 AGAAAGCATCAGAAAGAAGAAGG - Intronic
1133571835 16:7048552-7048574 ATAAAGAACCAAAAGGAGCTGGG - Intronic
1133624271 16:7555830-7555852 ATAAATACTGAGCAGGAGGAAGG - Intronic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134751411 16:16628261-16628283 AAAAAGAAAGAGAAAGAGGAAGG - Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1136387322 16:29937195-29937217 ATAAAAAAGCAGAAGAAGAAAGG + Intergenic
1136577904 16:31135174-31135196 AGAAAGAAAGAGAAAGAGGAGGG + Intronic
1137407266 16:48199436-48199458 AAAAAGAAACAGAAGAAGAAGGG + Intronic
1137526389 16:49240087-49240109 ATAAAGTTGCAGAAGGAGGCAGG - Intergenic
1137914154 16:52410609-52410631 ATAAAGACAGAGAAGGAGAATGG - Intergenic
1138124460 16:54427299-54427321 ACAAAAAATCAGGAAGAGGACGG - Intergenic
1138248953 16:55487865-55487887 AGAAAGAATGAAGAGGAGGAGGG - Intronic
1138298589 16:55908104-55908126 ATAAAGAATCAGACAGGGCAGGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1138649280 16:58449653-58449675 ATGAAGAATGAGATGGAAGAAGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139918823 16:70445949-70445971 AAAAAAAAAAAGAAGGAGGAAGG - Intergenic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141244204 16:82291214-82291236 AGAATGAAGCAGACGGAGGAAGG + Intergenic
1141268794 16:82520659-82520681 ATTAAGAATAGGCAGGAGGAAGG - Intergenic
1141479479 16:84296793-84296815 ATTAGGAATTAGGAGGAGGAAGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143000479 17:3791728-3791750 ATAATGAATCAGAATGGGGCTGG + Intronic
1143421116 17:6793140-6793162 AGAAAGAAAAAGAAGAAGGAAGG + Intronic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1143794703 17:9327301-9327323 AGAAAGAAGAAGAAGGAAGAAGG + Intronic
1143918858 17:10315026-10315048 ATAATGAAGAAGAAAGAGGAGGG + Intronic
1143946760 17:10599697-10599719 GTAAAGACTCAGAAGAAGAAAGG - Intergenic
1143964096 17:10743968-10743990 AAAAAGAGAAAGAAGGAGGAAGG - Intergenic
1144289135 17:13808734-13808756 AAAAAAAATCATAAGGAGGAGGG - Intergenic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144540087 17:16132913-16132935 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1144707537 17:17379511-17379533 ATACAGAAACAGAAAGCGGATGG - Intergenic
1144840338 17:18182243-18182265 AAAAAGAACGAGGAGGAGGAGGG + Intergenic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1145278729 17:21453408-21453430 TTAAAGCTTGAGAAGGAGGAGGG + Intergenic
1145399123 17:22517077-22517099 TTAAAGCTTGAGAAGGAGGAGGG - Intergenic
1146034469 17:29393880-29393902 GTACAGAATCAGAAGTATGAGGG + Intronic
1146179306 17:30687102-30687124 AAAAAGACTGTGAAGGAGGAAGG - Intergenic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1146973184 17:37089249-37089271 ATAAAGGAAGAGAAGGAGAAGGG - Intronic
1147421967 17:40326411-40326433 AGAAAGAACCAGAAGTCGGAAGG - Intronic
1147511898 17:41076990-41077012 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1147776570 17:42906133-42906155 AGAAAGAAAGGGAAGGAGGAAGG + Intronic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1148056996 17:44805110-44805132 ATACATTATCAGAAGGAAGATGG + Exonic
1148140173 17:45322603-45322625 ATAAAAATTCAGAATGAGGCTGG - Intergenic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1148193300 17:45695207-45695229 TAAAGGAGTCAGAAGGAGGAGGG + Intergenic
1148458677 17:47825030-47825052 AAAAAGAATCAGGATGAGGTTGG + Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148549292 17:48541263-48541285 TTAAAGAAACCTAAGGAGGATGG + Intronic
1148641988 17:49194473-49194495 AGAAAAAAAGAGAAGGAGGAGGG - Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149062431 17:52438653-52438675 AGAAAGAATTTCAAGGAGGATGG - Intergenic
1149235658 17:54587707-54587729 ATAGAGATTCAGTAGAAGGATGG + Intergenic
1149256149 17:54829000-54829022 ATAAAGTCACAGAAGGAGAATGG + Intergenic
1149344285 17:55718535-55718557 ATAAAAAATCAGAAAGTGAATGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150641073 17:66949896-66949918 ATAAAAACACAGAAAGAGGAGGG - Intergenic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1151484573 17:74390407-74390429 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1151742449 17:75992932-75992954 AGTAAGAATCAGAAGCAGGCAGG - Intronic
1152053894 17:78006602-78006624 AGAAAGAAGAAGAAGGAAGAAGG - Intronic
1152084062 17:78206652-78206674 AGAAAGAAGATGAAGGAGGAAGG - Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153302546 18:3603907-3603929 TTAAAGATTTAGAAGAAGGATGG + Intronic
1153460580 18:5328397-5328419 AAAAAGAAGAAGAAGAAGGAAGG + Intergenic
1153606743 18:6841279-6841301 AGAAAGAATAAGAAGGAATAGGG - Intronic
1153924914 18:9827260-9827282 CGAATGAATCAGAAGGATGAGGG + Intronic
1153948505 18:10037610-10037632 AGAAAATATTAGAAGGAGGAGGG - Intergenic
1154020441 18:10660128-10660150 AGAAAGAATTAGAAAGAGGGAGG - Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155139008 18:23026247-23026269 AAACAGAAACAGAAGGATGAAGG + Exonic
1155181437 18:23351732-23351754 ACAAAGAAACAGAAGGAGCGGGG - Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155509437 18:26562170-26562192 AGAAAGAGTGAGAAGGAGGATGG - Intronic
1155714557 18:28925466-28925488 ATAAAGAAAAAGAAAGAGAAAGG + Intergenic
1155827732 18:30469312-30469334 AGAAAGAATTCTAAGGAGGAGGG + Intergenic
1155887783 18:31228871-31228893 AAAAAAAAAAAGAAGGAGGAAGG + Intergenic
1156017496 18:32563145-32563167 AGCAAGAACCAGTAGGAGGAAGG + Intergenic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156126542 18:33912221-33912243 AAAAAGATTGAGAATGAGGAAGG - Intronic
1156167069 18:34434805-34434827 ATAATGACACACAAGGAGGAAGG - Intergenic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156446101 18:37237988-37238010 AAAAAAAATCAGAAGAAAGAAGG + Intergenic
1156692509 18:39725392-39725414 ACAAAGAATTAGAGAGAGGATGG + Intergenic
1157007360 18:43599583-43599605 ATACAGAAAAAGAAGGAAGAAGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158217774 18:55117724-55117746 AAAAAGTAGAAGAAGGAGGAGGG + Intergenic
1158443527 18:57499044-57499066 ATTAAGCATGGGAAGGAGGATGG - Intergenic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159300976 18:66567274-66567296 AGCAAGAAGCAGAGGGAGGAAGG + Intronic
1159309806 18:66692157-66692179 AAAAAGAAACAAAAGGAGGGTGG - Intergenic
1160241466 18:77127084-77127106 ATAAAGAATAATAAAGTGGAAGG + Intronic
1161023380 19:2022569-2022591 AGAAAGAAAGAGAGGGAGGAAGG - Intronic
1162145636 19:8611012-8611034 AGAAAGAATCAGGTGGGGGATGG + Intergenic
1162251158 19:9444693-9444715 AAAAAGAAAGAGAAGAAGGAAGG + Intergenic
1162776667 19:12983886-12983908 TGAAAGAGACAGAAGGAGGAAGG + Intergenic
1162875588 19:13618790-13618812 AGAAAGAGAGAGAAGGAGGAGGG + Intronic
1162979319 19:14228467-14228489 AAAAAGACTGTGAAGGAGGAAGG + Intergenic
1163092996 19:15034291-15034313 ACAAAGGATCAAAAGGAGGAAGG + Intergenic
1163262986 19:16202365-16202387 TTAAAGAATAAAAAGGAGGTCGG - Intronic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1165710035 19:38004479-38004501 ATAAAGAGACAGAAGGAAAATGG - Intronic
1166090519 19:40505685-40505707 AAAAAGAATGAAAGGGAGGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1168092790 19:54096637-54096659 AGAAAGAGGCAGAAGGAGAAAGG - Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168583004 19:57570805-57570827 GTAGAGAATCAGAAGGAGCCTGG - Intergenic
925191689 2:1890008-1890030 CAAAAGAATTAGAAGGATGAAGG + Intronic
925332348 2:3068456-3068478 AGAAAGAAAGAGAAGAAGGAAGG + Intergenic
925434712 2:3826964-3826986 ATAAACAATTGGAGGGAGGAAGG - Intronic
925572799 2:5330045-5330067 TTATTGACTCAGAAGGAGGAGGG - Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925762089 2:7194988-7195010 AGAAAGAATAAGAGGAAGGAAGG + Intergenic
926562601 2:14434473-14434495 ATAAAGCATGAGACTGAGGAGGG + Intergenic
926804880 2:16699040-16699062 TTAAAGACTCAGAAGTGGGAGGG + Intergenic
926839142 2:17059128-17059150 ATAAAGGAGCCGAAGGAGCAAGG - Intergenic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
926945930 2:18187365-18187387 AGAAAGAAAATGAAGGAGGAGGG - Intronic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927304376 2:21553893-21553915 ATATAGAACCACAAGGTGGAAGG + Intergenic
927529565 2:23782111-23782133 ATAAAGAAACAGAAGTTGGCTGG - Intronic
927910958 2:26899453-26899475 ATAGAAAATCACAAGGAAGAGGG - Intronic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928158514 2:28898968-28898990 AGAAACAATCAGAAGGCTGAGGG - Intronic
928572758 2:32625553-32625575 AGAAAAAATAGGAAGGAGGATGG - Intergenic
928614258 2:33020774-33020796 ACAAATACTCATAAGGAGGAAGG - Intronic
928908951 2:36399245-36399267 AGACAGAATCAGAAAGAAGATGG + Intronic
929485802 2:42353098-42353120 TTAAAGAAAAAGAAGGAGGGTGG + Intronic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930109488 2:47666425-47666447 AGAAAAAAGCAGAAGGAGAAAGG + Intergenic
930783083 2:55242636-55242658 GTAAAGAACCAGGAGGAGTAGGG + Intronic
931081425 2:58776020-58776042 ATAAAGGATCAGAACAAAGATGG + Intergenic
931952715 2:67383079-67383101 AGAAAGAATGAGATGAAGGATGG - Intergenic
931978661 2:67670637-67670659 ATAAATTTTCAGAAGGAGGATGG + Intergenic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932993136 2:76812797-76812819 AGGAAGAATAAGGAGGAGGAGGG - Intronic
933664169 2:84951118-84951140 AGAAAGGAAGAGAAGGAGGAAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934526480 2:95055273-95055295 AAAAAGAAGAAGAAGAAGGAGGG + Intergenic
934535325 2:95128610-95128632 AGAAAGAAAAAGGAGGAGGAGGG + Intronic
935283913 2:101546597-101546619 ACAACTAATCAGAAGAAGGATGG + Intergenic
935895040 2:107726715-107726737 ATAGAAAATCCGAAGGAAGAAGG + Intergenic
936012209 2:108932145-108932167 AGAAAGAAAGAAAAGGAGGAAGG - Intronic
936342165 2:111643304-111643326 AGAGAAAATTAGAAGGAGGAAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936371066 2:111902797-111902819 ATAAAGAAATAGAGGGAGGGAGG - Intronic
936475808 2:112838680-112838702 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
936929218 2:117769880-117769902 ATAAAGAAGAAGAAGAAGAAGGG + Intergenic
936941131 2:117885557-117885579 AAATAGAATCAGAAGAAGGGTGG - Intergenic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
937689725 2:124741814-124741836 AGAGAGAATAAGGAGGAGGAGGG - Intronic
937863679 2:126732347-126732369 AAAAAGAAAAAGAAGAAGGAAGG + Intergenic
938313282 2:130308786-130308808 AGAAGGAAAGAGAAGGAGGAGGG + Intergenic
938777325 2:134553509-134553531 ATAAAGACTGAGGAGCAGGAAGG + Intronic
939014181 2:136882376-136882398 AGAAAGAAGAAGAAGAAGGATGG - Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939554688 2:143660238-143660260 ATACAGAATGTGGAGGAGGAAGG - Intronic
939763477 2:146214716-146214738 CTAAAGATTTAGAAGGAAGATGG + Intergenic
939817589 2:146915421-146915443 GCAAGGCATCAGAAGGAGGAAGG + Intergenic
939987517 2:148845208-148845230 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
940077247 2:149756178-149756200 AGATAGCATAAGAAGGAGGAAGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940282093 2:151999090-151999112 ATAAGGAATCAGTAGGAACAGGG + Intronic
940502711 2:154514318-154514340 ATAAAGAGTTTAAAGGAGGAGGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940574868 2:155489964-155489986 ATGAAGAATGAAAAGGAAGATGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
944157490 2:196622572-196622594 AGAAAGAAACAGAAAGAGGGAGG - Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945703614 2:213201645-213201667 ATAAAGAAGGAGGAGGAGGGGGG - Intergenic
946795823 2:223351715-223351737 TTAAAGAATCAAAAGTAGGCTGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947013669 2:225593407-225593429 GGAAAGTCTCAGAAGGAGGAAGG - Intronic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
947147019 2:227077700-227077722 AAAAAAAAAAAGAAGGAGGAGGG + Intronic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
947598441 2:231429138-231429160 ATACAGAGACAGAAGGAGGGGGG + Intergenic
947671131 2:231936105-231936127 AGAAAGAAACAAAAGAAGGAAGG - Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948951333 2:241253828-241253850 ATAAAGAATGAGACAGAGCACGG + Intronic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1169009848 20:2241371-2241393 AGAAAGAAAAAGAGGGAGGAGGG - Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1169384442 20:5136281-5136303 AGAAAGAAACTGAAGGAGGGTGG - Intronic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1170462650 20:16591941-16591963 ATAAAGGAAGAGAAGGAGTATGG + Intergenic
1170690978 20:18614826-18614848 AGAAAGAGTGAGCAGGAGGAAGG - Intronic
1170882463 20:20309161-20309183 ATAAAGACTCAGGTGTAGGAGGG - Intronic
1171015526 20:21537608-21537630 AGAAAGAAAGAGAAAGAGGAGGG - Intergenic
1172266280 20:33617409-33617431 ATAAACTAGCTGAAGGAGGAAGG + Intronic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173215433 20:41077606-41077628 ATAAAGAAGGAGAAGGAAAATGG + Exonic
1173345796 20:42198933-42198955 AAAAAGAAAGAGGAGGAGGATGG - Intronic
1173433357 20:43011042-43011064 CTAACGAATAAGCAGGAGGATGG - Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173714161 20:45187772-45187794 ATAAACCATAAGAAGGTGGAAGG - Intergenic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174020008 20:47522487-47522509 ATACAGAGACAGAAGGAGGGGGG + Intronic
1174064080 20:47852185-47852207 ATAAAGGGTGAGAAGGAGGCGGG + Intergenic
1174379393 20:50146922-50146944 AACAAGAATCAGAAAGGGGAAGG - Intronic
1174988129 20:55478940-55478962 AACAAGATTCAGAGGGAGGAGGG + Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175433051 20:58920703-58920725 ATACAGAGACAGAAGGAGGGGGG + Intergenic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1176358914 21:5976169-5976191 ATAAAGGAAGAGAAGGATGATGG - Intergenic
1177833075 21:26161443-26161465 AGACAGAATAAAAAGGAGGAAGG - Intronic
1178150823 21:29791483-29791505 ACAAAGAAGAAGAAGGAGAAGGG + Intronic
1178155326 21:29846692-29846714 TTAAAGAATGAGAAGGGAGAAGG + Intronic
1178559989 21:33629557-33629579 ATAAAAAATCAGTAGGAGGCTGG - Intronic
1178562706 21:33654025-33654047 AGAAAGAAAGAGAAAGAGGAAGG - Intronic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1178708434 21:34892405-34892427 AGAAACATTCAGATGGAGGAAGG - Intronic
1179173360 21:38990194-38990216 ACAAAGAAGTAGAAGGAGAAGGG + Intergenic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1179764604 21:43562381-43562403 ATAAAGGAAGAGAAGGATGATGG + Intronic
1179803881 21:43825354-43825376 ATAAACATCCAGGAGGAGGAGGG - Intergenic
1181043471 22:20203786-20203808 ATAATTGATCAGAGGGAGGAGGG + Intergenic
1181565787 22:23736552-23736574 ATAAAGAAACAGAAGCTGGCCGG + Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181844755 22:25698183-25698205 AGAAAGAAAGGGAAGGAGGAAGG + Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182202260 22:28585815-28585837 ATAAAGAATCTGTAGAAAGATGG + Intronic
1182488372 22:30653363-30653385 AAAAAAAAAAAGAAGGAGGAAGG - Intronic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182709971 22:32315294-32315316 ATAAATAATAAAAAGTAGGAGGG + Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183090067 22:35516119-35516141 AGAAAGAAAGAGAAGAAGGAAGG - Intergenic
1183385404 22:37511373-37511395 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1184970232 22:48014495-48014517 TTTAAGAATCAAAAGGAGGCCGG - Intergenic
1184989903 22:48160292-48160314 AGAAAGAAGAAGGAGGAGGAGGG + Intergenic
1185019346 22:48365263-48365285 AGAAAGAAAGAGAAGGAGGGAGG + Intergenic
1203322938 22_KI270737v1_random:86152-86174 AGAAAGAAAGAAAAGGAGGAAGG - Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949438771 3:4057663-4057685 ATAAAGAATCATGACGGGGAAGG + Intronic
949626242 3:5869737-5869759 ATAAATGATCAGAAGAAAGAAGG - Intergenic
949817598 3:8076340-8076362 ATCAAGAGCCAAAAGGAGGAAGG - Intergenic
949823264 3:8138312-8138334 ATAAAGAAACAAAAGGAGGCTGG + Intergenic
949988917 3:9561088-9561110 ATGAAGAGTCAGAAGGGCGAGGG - Intergenic
950358222 3:12429569-12429591 AAAAAGAAGCAGGTGGAGGAAGG + Intronic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
951152551 3:19308827-19308849 AGAAAGAGGGAGAAGGAGGAGGG - Intronic
951813358 3:26726364-26726386 AAAAAGTTTCAGAAGTAGGATGG + Intergenic
951824999 3:26859056-26859078 AGGAAGAATCACTAGGAGGAAGG + Intergenic
951838817 3:27011516-27011538 ATATAGGAACAGAAGGAAGAGGG - Intergenic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952084288 3:29798419-29798441 AGAAAGAAAGAGAAGGAGAAAGG + Intronic
952330155 3:32357305-32357327 ATAAAGAAAAAGAAGGAAGGAGG - Intronic
952449124 3:33414271-33414293 AAAAAGAAAGAGAGGGAGGAGGG + Intronic
952567623 3:34678512-34678534 AGAAAGAATAAAAAGAAGGAAGG + Intergenic
952578053 3:34798532-34798554 ATAAACAATGAGAGAGAGGAAGG + Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952652986 3:35748269-35748291 AGAAAGAAAGAAAAGGAGGAAGG + Intronic
952667561 3:35925077-35925099 ATAAAGAATGAGAATTAAGAAGG - Intergenic
952978601 3:38717329-38717351 AGGAAGAATCAGTAGGAAGATGG + Intronic
953146587 3:40281694-40281716 GTAAAGATTCAGAAGGCGGGCGG - Intergenic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954895713 3:53973168-53973190 ATAAAGAATAAGAAGGAAGCTGG - Intergenic
954900739 3:54017111-54017133 AAAAAAACTCAGAGGGAGGAAGG - Intergenic
954999867 3:54917729-54917751 ATAAACAAACACAAAGAGGATGG - Intronic
955087839 3:55720282-55720304 ATAAAGAAAGAGAGGGAGGGAGG - Intronic
955208226 3:56916751-56916773 ATAAAGCATCACTAGGAGAAGGG + Intronic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
955565539 3:60240628-60240650 ACAAAGAAAGAGAAGGAAGAGGG + Intronic
955730488 3:61980486-61980508 AGAAAGAGGGAGAAGGAGGAGGG + Intronic
955731872 3:61995760-61995782 AAAAAGAAAAAGAAGGAGGGAGG - Intronic
955783627 3:62512750-62512772 ATAGAGAATCAAAAGGATGCAGG - Exonic
955821785 3:62903867-62903889 TTAAACAATCAGGAGGAGAATGG - Intergenic
955963513 3:64364789-64364811 ATAAGGAATCAAAAAGAGCAAGG + Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957047336 3:75386185-75386207 AGAAAGAAGGAGAAGAAGGAAGG + Intergenic
957334163 3:78805326-78805348 ATTAAGAAACAAAAGAAGGAGGG - Intronic
957607692 3:82423833-82423855 ATAAAGTATGAGAAGGGAGAAGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957842853 3:85693589-85693611 AGAAAAAATCAGAAGGAGGCTGG + Intronic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958255887 3:91324414-91324436 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958862544 3:99462475-99462497 ATAGAGAATAAATAGGAGGATGG + Intergenic
958936869 3:100264300-100264322 ATAAAGAAAGAGAGGGAGGGAGG - Intronic
959563111 3:107805159-107805181 AGACAGAATGGGAAGGAGGAAGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
960273978 3:115705989-115706011 ATAAGGAATCAGAATGGGGTAGG - Intronic
960512142 3:118563346-118563368 ATAAGCAATCAAAAGGAGAATGG + Intergenic
961134972 3:124501890-124501912 ATAGAAAACCAGAAGGAGAAAGG + Intronic
961228049 3:125271815-125271837 TAAAAGAACCAGAAGGAGGCAGG - Intronic
961693641 3:128688716-128688738 ATATATACTCTGAAGGAGGAAGG + Intergenic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962937042 3:140090773-140090795 ATCAAGACTCAGAAGCAGGCTGG + Intronic
963299598 3:143583973-143583995 GTAATGAAGAAGAAGGAGGAGGG + Intronic
963431287 3:145207688-145207710 AAAAAGAAAAAGAAGGAGGGAGG + Intergenic
964550348 3:157878241-157878263 AGAAAGAATCAGAATGATCAAGG + Intergenic
964577067 3:158183064-158183086 GTAAAGAATTAGAAAGGGGAAGG - Intronic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965263071 3:166507850-166507872 AGAAAGAAGTAGAAGGAGAAAGG - Intergenic
965276986 3:166696810-166696832 ACAAAGAAACAGAAGGTTGATGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965593016 3:170380081-170380103 ATAAAGAAAAATAAGGAGAAAGG - Intronic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
966238146 3:177725743-177725765 ATAAAGAGACATGAGGAGGATGG + Intergenic
966248149 3:177831651-177831673 CCATAGAATCTGAAGGAGGAAGG - Intergenic
966316573 3:178653399-178653421 ATAAAGAATAAGAATTAGAAGGG - Intronic
966393114 3:179473912-179473934 ATAAAGGATGAGAAGAAAGAGGG + Intergenic
966460660 3:180172767-180172789 ATAAAGAGTCTGAAGGAAGTGGG - Intergenic
966759767 3:183407550-183407572 AAAAAGAAGCAGAAGAAAGAGGG - Intronic
967038249 3:185664435-185664457 ATAAAGAATCACCAGCATGAAGG + Intronic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
968244803 3:197133829-197133851 AAAAAGTGTTAGAAGGAGGAAGG + Intronic
969087091 4:4664538-4664560 AGAAAACATCAGAAGCAGGAAGG + Intergenic
969834376 4:9828116-9828138 ATAATCAATCAGAAGGATGGAGG - Intronic
970200314 4:13598131-13598153 ATAAAGTATCTGAAGTTGGACGG + Intronic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970974309 4:22025267-22025289 AGAAGGGATTAGAAGGAGGATGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971447062 4:26762172-26762194 AGACAGATTCAGAAGGAGGTAGG + Intergenic
972083088 4:35178667-35178689 ATAAAAAAACAGAAGGACGACGG + Intergenic
972116880 4:35647136-35647158 AAAAAGAATATGAAGCAGGAAGG + Intergenic
972129296 4:35809976-35809998 AGAAAGAAACAGAGAGAGGAGGG - Intergenic
972274676 4:37546038-37546060 ATAGATGATGAGAAGGAGGATGG + Intronic
972343050 4:38169255-38169277 ATAAAGAATCCGATACAGGATGG - Intergenic
972657509 4:41078995-41079017 ATAAAGAGGCAGGAGCAGGAGGG + Intronic
972790241 4:42364867-42364889 AGAAAGAAAGAGAAAGAGGAAGG - Intergenic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
974845794 4:67350224-67350246 AAAAAGAGAAAGAAGGAGGATGG + Intergenic
975340630 4:73235815-73235837 AGAAAGAAAAAGAAGGAAGAAGG + Intronic
975504421 4:75122660-75122682 AGAAAGAATAAGAAGAAGGAGGG + Intergenic
975504436 4:75122774-75122796 AGAAAGAATAAGAAGAAGGAGGG + Intergenic
975868296 4:78749152-78749174 AAAAAAAATCAGAAGGATGAAGG + Intergenic
975967581 4:79993264-79993286 ATAAAGAAAGAGAGGGAAGAAGG + Intronic
976000959 4:80372525-80372547 ATAAAGTATCACAGAGAGGATGG - Intronic
976081368 4:81358874-81358896 ATAAAGAATAAGGAGGGAGATGG + Intergenic
976184178 4:82429248-82429270 AGCAAGAATCAGCAGGATGACGG - Exonic
976484162 4:85581081-85581103 ATAAGAAATCAGAAACAGGAAGG - Intronic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
977187528 4:93958714-93958736 ATAATGAATCAAAATGAGAAAGG - Intergenic
977429368 4:96912210-96912232 AGAAAGAAAAAGAAAGAGGATGG + Intergenic
977599077 4:98916298-98916320 AAAAAGGAAGAGAAGGAGGATGG + Intronic
978623094 4:110654160-110654182 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
979199806 4:117963597-117963619 ATCAAGAATTAGAAAGAAGATGG + Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
979829616 4:125283119-125283141 ATAAACAAACAAAAGAAGGATGG + Intergenic
980140665 4:128912726-128912748 ACAAAGAAAAAGGAGGAGGAGGG - Intronic
980624846 4:135361425-135361447 ATAAAGAAATAAAAGGTGGAAGG + Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981309443 4:143282410-143282432 ATAAAGATTAAGAAAGAGGAGGG + Intergenic
982119722 4:152130993-152131015 AAAAAGGACGAGAAGGAGGAAGG - Intergenic
982448164 4:155519122-155519144 GTAAAGAAACAAAGGGAGGAGGG + Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982689695 4:158534027-158534049 ATAAATAATTGGAAGGAGTAAGG + Intronic
982882522 4:160737899-160737921 ATAAAGAAACAGAAGCAGACTGG - Intergenic
982941228 4:161559327-161559349 AGAAAGAACAAGGAGGAGGATGG - Intronic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
984351739 4:178603183-178603205 ATAAGGAATCAGAATGAAGATGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984633428 4:182085073-182085095 ATAAAGAAAGAGGAAGAGGAAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985075383 4:186208944-186208966 ATAAAGGAACAGAAGGAAAAAGG - Exonic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
986936626 5:12896142-12896164 ATAAAGACACAGAAGAAAGAAGG + Intergenic
987384709 5:17318360-17318382 ATTAAGAACCAGAAGAAGGCTGG + Intergenic
987785923 5:22498471-22498493 ATAAAATATCAGTAGGGGGATGG - Intronic
988000159 5:25337541-25337563 ATAAAGATTCAAAAGAAGGCAGG + Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988089614 5:26519699-26519721 AGAAAGAAGGAGAAGGAAGAAGG + Intergenic
988179950 5:27777691-27777713 AGAAAGAATGAGAAGAAGGAAGG + Intergenic
988454078 5:31372213-31372235 AAAAACAATCAGAAGAAGAAGGG - Intergenic
988683201 5:33503155-33503177 AAATAGAATCTGAAGTAGGAAGG - Intergenic
988994851 5:36705072-36705094 ATAAAGAATCAGCAGCAACAGGG + Intergenic
989164834 5:38423864-38423886 ATAAAGACTCACTGGGAGGAGGG - Intronic
989602618 5:43213962-43213984 AGAAAGAAAGAGAAGAAGGAAGG - Intronic
989756219 5:44958781-44958803 AGAAGGAAAAAGAAGGAGGAAGG - Intergenic
990516087 5:56532054-56532076 GCAAAGAATCAGAGGTAGGAAGG - Intronic
990723451 5:58725442-58725464 ATAAATAATCAGAGGTAGCAAGG - Intronic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
991295724 5:65078166-65078188 AGAAAGAAACAGAAAGAGAAAGG + Intergenic
991368283 5:65891787-65891809 ATAAAGAATCAGGCATAGGAGGG + Intergenic
991607124 5:68413812-68413834 GTAAACAATCGGAAGGAGGAAGG + Intergenic
991608300 5:68425120-68425142 TTATATAATCAGAAGTAGGAAGG + Intergenic
992004465 5:72463706-72463728 AGAAAGGACCAGCAGGAGGATGG + Intronic
992244749 5:74809151-74809173 ATAAAGAATAAACAGTAGGATGG + Intronic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992719255 5:79543667-79543689 ATAAAGAATGAGAAACAGGCTGG - Intergenic
993392520 5:87338003-87338025 ATAATGAATTAGAAGATGGATGG + Exonic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
993478521 5:88394569-88394591 AGAAAGAATGGGGAGGAGGAAGG - Intergenic
993854819 5:93061080-93061102 ATCAAGAATTAGGAAGAGGAGGG - Intergenic
994159135 5:96536055-96536077 TTAAAGAAAAAGGAGGAGGAGGG + Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995019047 5:107346540-107346562 ATAAAGTATCACAAGGCAGAAGG + Intergenic
995085943 5:108109234-108109256 AGAAAATAGCAGAAGGAGGAAGG + Intronic
995156661 5:108922326-108922348 ATAAATGATCTGAAAGAGGAGGG + Intronic
995290694 5:110448704-110448726 GGAAAGTATCAAAAGGAGGAAGG + Intronic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995948438 5:117680057-117680079 AGAAAGAAACAAAAGAAGGAAGG - Intergenic
996400688 5:123059035-123059057 TTAAAGACTCAGAAGAGGGAGGG + Intergenic
996912750 5:128674166-128674188 ATAAAGAAACAGCAGGAGGCGGG - Intronic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997037089 5:130205833-130205855 AGATGGAATGAGAAGGAGGAGGG - Intergenic
997329211 5:133047053-133047075 AGAAAGAAAGAGAAGTAGGAAGG - Intergenic
997532061 5:134587559-134587581 ATAATGAATAAAAAAGAGGAGGG + Intergenic
997655079 5:135548585-135548607 ATAATGGGGCAGAAGGAGGATGG - Intergenic
997948398 5:138222423-138222445 ATAAAGAATAAGAAGGGGCTGGG + Intergenic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
999028253 5:148259900-148259922 ATAAACAATTATAAGGAGGTTGG - Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999380520 5:151117991-151118013 TTACAAAATCAGCAGGAGGATGG - Intronic
999537004 5:152528682-152528704 ATAAGGAGCCAGAAGGGGGATGG + Intergenic
1000133214 5:158319905-158319927 ATAGAAAATCACAGGGAGGAGGG - Intergenic
1000217408 5:159174700-159174722 ATAAAAACACAGTAGGAGGAAGG - Intronic
1000288300 5:159846765-159846787 AAAAAGATTCAGAGGCAGGATGG + Intergenic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001108369 5:168875126-168875148 AGAAAGAATGAGAGGGAGGAAGG + Intronic
1001143697 5:169166021-169166043 ATAAAGAAACAGAAACAGGGAGG + Intronic
1001511097 5:172322499-172322521 AGAAAGAAAAAGAAGAAGGAAGG - Intergenic
1001737804 5:174021087-174021109 AGAAAGAAGAAGAAGAAGGAAGG + Intergenic
1001852624 5:174982802-174982824 AGAAAGAAAGAGAAGGAGGGAGG - Intergenic
1003052744 6:2794647-2794669 ATAAACAATCATAAGGCAGAAGG - Intergenic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004077758 6:12360802-12360824 ATAAATGAACATAAGGAGGAAGG + Intergenic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1004357463 6:14942496-14942518 AGAAAATAGCAGAAGGAGGAAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005870875 6:29974050-29974072 ATATAGAATTAGAAAGAGGCTGG + Intergenic
1007271423 6:40640436-40640458 AGAAAGAATGAGAAGGAGGGAGG - Intergenic
1007302337 6:40876704-40876726 AGAAAGAATGGGAGGGAGGAAGG - Intergenic
1007828922 6:44623225-44623247 AGAAAGAAGAAAAAGGAGGAAGG - Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008494535 6:52119396-52119418 GTAAACAACCAGAAGTAGGATGG + Intergenic
1008713748 6:54262786-54262808 TTTAAGAAAAAGAAGGAGGAGGG + Intronic
1008717851 6:54310631-54310653 AGAAAGAAAGAGAGGGAGGAAGG - Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1010022538 6:71177468-71177490 ATAAAACATCAGGATGAGGATGG + Intergenic
1010292035 6:74148398-74148420 ATAAAGAAACAGAAACAGGGAGG - Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010520387 6:76825104-76825126 ATAAAGAATCAGAAGTGATAGGG - Intergenic
1010577278 6:77547917-77547939 ATAAAGCATCAGAAGGTGAAAGG - Intergenic
1010828423 6:80501167-80501189 ATAGAGACTCCGAAGGATGAGGG + Intergenic
1011113126 6:83860059-83860081 ATAAAGGACCAGAAAGAAGAGGG - Intronic
1011421332 6:87176540-87176562 AGAAAGTAGCAGAAGCAGGAAGG - Intronic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1012871843 6:104682333-104682355 AAAAAGCATCAGAAGAAAGATGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013312084 6:108904656-108904678 AAAAAGAAGAAGAAGAAGGAAGG + Intronic
1013434239 6:110085732-110085754 AAAAAGAATCAAAAGGAGCTTGG + Intergenic
1013752546 6:113423796-113423818 ACAAAGAAAGAGAAGGATGAAGG - Intergenic
1014207566 6:118672779-118672801 AGAAAGAAGAAGGAGGAGGAAGG + Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014487918 6:122023469-122023491 GTAAACAATCAGAAGCATGAGGG + Intergenic
1014760659 6:125353081-125353103 ATAAAGAAAGAGAACGAGAAAGG + Intergenic
1015091503 6:129364234-129364256 GTAAACAAAGAGAAGGAGGACGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015553005 6:134431619-134431641 ATAGGGAGTAAGAAGGAGGACGG + Intergenic
1015615928 6:135075233-135075255 AGAAAGAGAAAGAAGGAGGAAGG - Intronic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016699484 6:147038157-147038179 AGAAAGAGTCTGAAGGAAGATGG + Intergenic
1016703996 6:147085537-147085559 AAAAAGAATGGGAACGAGGAGGG - Intergenic
1016802646 6:148182357-148182379 ATAAAGAAAAAGAGGGAGGGAGG + Intergenic
1016897051 6:149063705-149063727 AGAAACCATCAGAAGGACGAGGG - Intronic
1016908462 6:149174008-149174030 TCAAAGAACAAGAAGGAGGAAGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017175539 6:151500374-151500396 AAAAAGAAACAGAAGGAATAGGG + Intronic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017965876 6:159265597-159265619 ACAAAGAAAGAGAAGGAGGGCGG + Intronic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018623884 6:165758688-165758710 AGAAGGAAGGAGAAGGAGGAGGG + Intronic
1018992120 6:168682112-168682134 ATCAAGAAACAAAAGGAGGGAGG + Intergenic
1019265175 7:111115-111137 CGAAAGAAACAGAAGGAGCATGG - Intergenic
1019273955 7:166219-166241 ACAGAGAATAGGAAGGAGGAAGG - Intergenic
1019484141 7:1280823-1280845 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484170 7:1280976-1280998 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019568698 7:1697679-1697701 ATAAAGTCCCGGAAGGAGGAGGG - Intronic
1020851926 7:13364380-13364402 ATAAAGACACAGAGGGAGGGGGG - Intergenic
1020866259 7:13567551-13567573 AGAAAGTATCAGATGGAAGAGGG - Intergenic
1020914876 7:14180363-14180385 GAAAAAAATCAGAAGGAGGGTGG - Intronic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1021394347 7:20128981-20129003 AAAAAGAATGAGAAAGAGAAAGG + Intergenic
1021396294 7:20152624-20152646 ATAAACACTCAGAAGCAGAAAGG - Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1022027897 7:26465914-26465936 CTAAAGGAACAGAAGGAGCAAGG + Intergenic
1022333772 7:29403709-29403731 ATAAAGAATCAGTGGGGAGACGG - Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023161519 7:37301247-37301269 AAAAACAATCAGAAGGAAAAGGG + Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1026079399 7:67204491-67204513 ATAAAAAAAGAGAAGAAGGAAGG - Intronic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026326181 7:69312773-69312795 ATAATGAAACAAGAGGAGGATGG - Intergenic
1026715787 7:72788273-72788295 ATTAAGAATGACAAGGAGGCCGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027802572 7:82774033-82774055 CTAAAGAATCATGAGGAGGGAGG - Intronic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1029040425 7:97567121-97567143 ACAAAGTCTCAGAAGGTGGAAGG - Intergenic
1029927490 7:104332733-104332755 ATAAAGACTTAGAGTGAGGAGGG - Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030463084 7:109865002-109865024 ATATACAATCAGTAGGAAGAAGG - Intergenic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1030768406 7:113441376-113441398 ATAAGGAGTGAGAAGGAGGCAGG - Intergenic
1031626992 7:124003591-124003613 ATCAAGATTCAGGAGGAGGATGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1032655831 7:133928743-133928765 AAAAAGCATTAGAAAGAGGAAGG + Intronic
1032742589 7:134753717-134753739 ATAAAGAACATGAAGGAGAAAGG - Intronic
1032746949 7:134795612-134795634 AGAAAGAAAGAAAAGGAGGAGGG - Intronic
1032879231 7:136071461-136071483 AGAAAGAATAAAAGGGAGGAAGG + Intergenic
1032952247 7:136928127-136928149 AAAAAGAAGCAGAGGAAGGAGGG + Intronic
1033277646 7:139984695-139984717 AGAAAGAAAAAGAAAGAGGAAGG + Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1035111098 7:156482532-156482554 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1036405151 8:8448147-8448169 TTAAAGACTCAGAAGGCAGAGGG + Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1036587731 8:10140331-10140353 AGAAAGCAGCAGAAGCAGGAAGG - Intronic
1036708436 8:11061768-11061790 CCAAAGAATGAGAAGAAGGAAGG + Intronic
1037319885 8:17632156-17632178 AGAAAGGATCGGGAGGAGGAGGG - Intronic
1037409111 8:18575954-18575976 ATAAAATATGGGAAGGAGGAAGG - Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038777092 8:30540865-30540887 AGAATGAATGAGAGGGAGGATGG + Intronic
1038820895 8:30951107-30951129 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1038832991 8:31083990-31084012 ATAAAAAATAAGAAGGAACAAGG - Intronic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1038890208 8:31713095-31713117 AAAAAAAATTAGAAGGAGTATGG - Intronic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039412691 8:37368535-37368557 AGGAAGAATGAGAGGGAGGAAGG + Intergenic
1039583342 8:38684922-38684944 AGAAAGAAAGAGAAGAAGGAAGG + Intergenic
1039743062 8:40399727-40399749 ACAAAGCATGGGAAGGAGGATGG - Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1040079432 8:43272342-43272364 AGAAAGAGTGAGAAGAAGGAGGG + Intergenic
1040659688 8:49556915-49556937 ATAAAGAAATACAAGGAGGCTGG + Intergenic
1040674609 8:49733707-49733729 ATAAACAATTATAAGGAGGCTGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1042392572 8:68252984-68253006 ATAAAGTAACATAAGGATGAGGG - Intergenic
1042495311 8:69449084-69449106 ATAAAATATCAGAATGAGAATGG + Intergenic
1042732229 8:71948775-71948797 AGAAAGAATGAAAAGAAGGAAGG + Intronic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042934694 8:74046886-74046908 AAAAAGAATGAGAATGAGAATGG - Intergenic
1043231915 8:77813900-77813922 ATAAAGAATTAGGTGGAGGGAGG - Intergenic
1043343014 8:79264647-79264669 ATAAAGAAACAGAAGTCTGAAGG + Intergenic
1044236331 8:89835014-89835036 ATACAGAATGAGGAGGAGAAAGG + Intergenic
1044392356 8:91666320-91666342 ATAGAGAATGAGTAGAAGGAGGG - Intergenic
1044554238 8:93544704-93544726 ATAAATAAAAAGAAGGAGTAAGG + Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1044985521 8:97753283-97753305 AAAAAGAAGAAGAAGGAAGAAGG + Intergenic
1045694293 8:104790589-104790611 AAAAAGAATAAGAAGAACGAAGG - Intronic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045937056 8:107692152-107692174 ATAAATAAACTGAAAGAGGAAGG + Intergenic
1046006102 8:108487325-108487347 TTAAAGAATCATAAAGAGTAGGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1046614922 8:116465585-116465607 ATAAATAAACTGAAGCAGGAGGG + Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1047889185 8:129288458-129288480 ATAAAGACTCAGAAGAGGGAGGG + Intergenic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048072515 8:131037651-131037673 AGAAGGAAAAAGAAGGAGGAAGG + Intronic
1048456852 8:134586191-134586213 ATAAAGATTCAGAAAGCGAAAGG - Intronic
1048516490 8:135116307-135116329 ATAAAGAATTAGAGGATGGAGGG + Intergenic
1048525466 8:135198352-135198374 ATGAAAAATCAGAGGGAGGGAGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1048614827 8:136061626-136061648 ATAAAAAATAAGAAGGAAAAAGG + Intergenic
1049066550 8:140321010-140321032 ATAAAGTGTCAAAAAGAGGAGGG + Intronic
1049101102 8:140579712-140579734 ATAGAGACTGAGAAGGAGAACGG + Intronic
1050358544 9:4805384-4805406 AAAAAGAAGAAGAAGGAGAAGGG + Intronic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1051012558 9:12436252-12436274 CAAAAGACTCAGAAGGGGGAAGG - Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051099715 9:13507029-13507051 ATCAAGACTCACAAGGAGGCTGG + Intergenic
1051457303 9:17272933-17272955 ATAAACAACTAGATGGAGGAAGG - Intronic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1052099653 9:24429808-24429830 ATAAAGTATGCCAAGGAGGATGG - Intergenic
1052295761 9:26894753-26894775 ATACAGAACCAGAGGGAAGAGGG - Intergenic
1052766543 9:32647103-32647125 ATAAAACATCAGAATGAGAAAGG - Intergenic
1052976794 9:34417063-34417085 AAAAAGAAGAAGAAGGAGAAGGG - Intronic
1053177744 9:35940947-35940969 AGAAAGAGTGACAAGGAGGAAGG - Intergenic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1053678029 9:40457715-40457737 ATAAAGAAATATAAGGAAGAAGG - Intergenic
1053874360 9:42528423-42528445 ATAAAGCATCAAAAGTAGAAGGG + Intergenic
1054267975 9:62938331-62938353 ATAAAGCATCAAAAGTAGAAGGG - Intergenic
1054285705 9:63167225-63167247 ATAAAGAAATATAAGGAAGAAGG + Intergenic
1054291101 9:63293252-63293274 ATAAAGAAATATAAGGAAGAAGG - Intergenic
1054389118 9:64597787-64597809 ATAAAGAAATATAAGGAAGAAGG - Intergenic
1054506596 9:65918583-65918605 ATAAAGAAATATAAGGAAGAAGG + Intergenic
1054741961 9:68815318-68815340 TTTAAGAATCAGAAGAAAGAAGG + Intronic
1054944765 9:70784104-70784126 ATAAATACTCAGAAGAAGGCGGG - Exonic
1055087218 9:72326480-72326502 ATAAAGAACCAGATAGAGGCTGG + Intergenic
1055423174 9:76164992-76165014 AGAAAGATTGAGAAGGAGAAAGG - Intronic
1055652025 9:78415499-78415521 AAATAGAATCATGAGGAGGATGG + Intergenic
1055720060 9:79163409-79163431 ATAAAGAATCACTAGGAGGTAGG - Intergenic
1055722008 9:79185425-79185447 ATAAAGAATCCCAAGGAACAGGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1059346640 9:113633445-113633467 ATAAAGAATCAGAAGCTGGCCGG + Intergenic
1059352903 9:113678151-113678173 AGAAAGAAAAAGAAAGAGGAAGG - Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059527040 9:115001673-115001695 ATAATGAATTTGAAGGAGGTAGG - Intergenic
1059918316 9:119129117-119129139 AATAAGAATGAGGAGGAGGAGGG + Intergenic
1060163004 9:121383943-121383965 TGAAAGGATCAGAAAGAGGAAGG + Intergenic
1060451826 9:123750022-123750044 GAAAAGAATCAGGAGGAGAAAGG + Intronic
1061141479 9:128770110-128770132 AGAAAGAAACAGTGGGAGGATGG - Intronic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1061505053 9:131027081-131027103 CTAATGAACCAGAAGGAAGACGG + Intronic
1061632470 9:131881783-131881805 AAAAAGAAGAAGAAGAAGGAAGG - Intronic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1203652040 Un_KI270751v1:134584-134606 ATAAAAAAAAAGAAGGAGGTTGG + Intergenic
1185814986 X:3146313-3146335 AAAAAGAAGAAGAAGGAAGAGGG - Intergenic
1186068292 X:5790140-5790162 AGAAAGAAAGAGAAAGAGGAAGG + Intergenic
1186087590 X:6007308-6007330 ATAAAGTGTCAGGAGGTGGAAGG + Intronic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1186384586 X:9096277-9096299 ATAAAAGATGAGAAGAAGGAAGG + Intronic
1186456873 X:9716645-9716667 AAAAAAAATCCCAAGGAGGAGGG - Exonic
1186677594 X:11835380-11835402 AGAAAGAAGGAGATGGAGGAGGG - Intergenic
1186806212 X:13142896-13142918 ATAAAAAGAAAGAAGGAGGAAGG - Intergenic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187707778 X:22024968-22024990 ATCAAGGAGCAGAAGGAGCAAGG - Intergenic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189751466 X:44226903-44226925 AAAAAGAAAAAGAAGAAGGAAGG + Intronic
1190410134 X:50128998-50129020 AGAAAGAAAAAGAAGAAGGAAGG - Intergenic
1190779754 X:53582665-53582687 ACAAAGAATCAGCAGAAGAAAGG + Intronic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1191955122 X:66635838-66635860 ATAAGGAATCAGTGGGATGATGG + Intronic
1192095669 X:68207975-68207997 AGAAAGAAGGAAAAGGAGGAAGG - Intronic
1192432246 X:71120237-71120259 ATCTAGATTAAGAAGGAGGATGG - Intronic
1192807512 X:74523521-74523543 ATAAAGGGTCAGAAGGGGAAAGG - Intronic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193578034 X:83227991-83228013 AAAAATAATAAGAAGAAGGAGGG - Intergenic
1193878324 X:86891362-86891384 ATCACAAATCAGAAAGAGGAAGG + Intergenic
1194072760 X:89348262-89348284 ATAAAAATTCAGAATAAGGAGGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194116284 X:89902521-89902543 AAAAATAATCAGAAACAGGAGGG + Intergenic
1195002129 X:100651958-100651980 ACAAAGAATCAGAAATAGAAGGG - Intronic
1195101609 X:101560594-101560616 AAAAAGAATGAGAAGGAACAAGG - Intergenic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1197045845 X:121997272-121997294 AAAAAGACTAGGAAGGAGGAGGG + Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197430322 X:126354936-126354958 ATTAAGAATCAGAAGAGGCAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1197868137 X:131039872-131039894 ATAAAGACTCAGGAGAAAGATGG + Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198013285 X:132582114-132582136 AGAAAGAATAAGAAGGAACAGGG - Intergenic
1198035040 X:132793499-132793521 ATAAAGATACAGGAGGAAGATGG - Intronic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198251890 X:134887124-134887146 ATAAAGAAACAGAAGTAGCCTGG + Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199751592 X:150824495-150824517 AGAAAGAAGAAGAAGAAGGAAGG + Intronic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200839655 Y:7768082-7768104 GTAAAGAATCAGGAGTAGGTTGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1202302929 Y:23436903-23436925 ATACAGAGTAAGAAGAAGGACGG + Intergenic
1202567882 Y:26233691-26233713 ATACAGAGTAAGAAGAAGGACGG - Intergenic