ID: 999115412

View in Genome Browser
Species Human (GRCh38)
Location 5:149159014-149159036
Sequence CACAGGGAAATATCTAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 8, 3: 29, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999115412 Original CRISPR CACAGGGAAATATCTAGGAG AGG (reversed) Intronic
901947462 1:12715438-12715460 CACAGGGAAAAACCAAGCAGTGG + Intergenic
902252949 1:15167537-15167559 CTTGGGGAAATACCTAGGAGTGG + Intronic
904891256 1:33781341-33781363 GACAGGGAAATACAAAGGAGGGG - Intronic
905002930 1:34687553-34687575 CTCAGGTAAAAACCTAGGAGTGG + Intergenic
905774874 1:40662013-40662035 CACAGGGAAAAGGGTAGGAGAGG + Intronic
908870458 1:68605195-68605217 CACAGTGAAAAATCTTGGAATGG + Intergenic
910814142 1:91271710-91271732 GACAGGGAAATATATAGTTGAGG + Intronic
911261895 1:95696382-95696404 CATAGGGAATTATTTAGGAAAGG - Intergenic
913304479 1:117411943-117411965 AACAAGGAAATATTTAGGAGTGG - Intronic
914044491 1:144079221-144079243 CAAAGGGAAATATGCAGTAGAGG - Intergenic
914133619 1:144881465-144881487 CAAAGGGAAATATGCAGTAGAGG + Intergenic
915051043 1:153072448-153072470 CACAGGGAAAGATATAGGCATGG - Intergenic
915737222 1:158092729-158092751 CACAGGGAAAGATCTCAGAGGGG + Intronic
916162663 1:161934453-161934475 CACTAGGAAACATCTAGGATTGG - Intronic
920375125 1:205504283-205504305 TACAGGGAGGTACCTAGGAGAGG + Intergenic
921339785 1:214123302-214123324 CAAAGGGAAAGAGCCAGGAGGGG - Intergenic
921470218 1:215538945-215538967 CACCTTGAAATATCTAGCAGAGG + Intergenic
921974883 1:221191505-221191527 CATAAGGAAATATTTAGGAATGG + Intergenic
922010736 1:221583279-221583301 CTTAGGTAAATATCTAAGAGTGG - Intergenic
922116677 1:222619498-222619520 CACAGGGTTATCTCTAGGAATGG - Intronic
923360003 1:233201711-233201733 CACAGGGAAAAGTCTAGGTATGG + Intronic
1062789192 10:290705-290727 GAGAGGGAAAGAACTAGGAGGGG + Intronic
1064471568 10:15640835-15640857 CACAGGGAAATTTTGAGCAGAGG + Intronic
1064798976 10:19047033-19047055 CAGAGGGAAATAGATAGGAGTGG + Intergenic
1065051765 10:21799786-21799808 CTCAGGAAAATTTCTAGGAAAGG + Intronic
1065125167 10:22566892-22566914 CACACAGAAAGATCTAGCAGGGG - Intronic
1065594676 10:27298828-27298850 AACAGAGAAATATCTGGAAGGGG - Intergenic
1065703070 10:28444301-28444323 CACAGCTAAGTATCTAGGGGAGG - Intergenic
1066238478 10:33510111-33510133 CAAAGAGAAATAACTAGGAAGGG + Intergenic
1067516239 10:46947951-46947973 TTAAGGTAAATATCTAGGAGTGG + Intronic
1068737978 10:60436318-60436340 CTCAGGAAAATACCTAGGAGTGG + Intronic
1070014224 10:72509530-72509552 AACAAGTAAATATCTAGTAGAGG - Intronic
1072073666 10:91946436-91946458 CTCAGGTAGATACCTAGGAGTGG + Intronic
1072711069 10:97715712-97715734 CCCAGGGAATTCTCTAGCAGAGG + Exonic
1073389605 10:103163282-103163304 CTAGGGTAAATATCTAGGAGTGG + Intronic
1073673938 10:105623837-105623859 CTTAGGTAAATACCTAGGAGTGG + Intergenic
1073984551 10:109193409-109193431 CACATGGTAGTATCTAGGGGTGG + Intergenic
1074009527 10:109462959-109462981 CTAGGGGAAATACCTAGGAGTGG - Intergenic
1077149972 11:1068131-1068153 GCCAGGTAAATACCTAGGAGTGG - Intergenic
1077657221 11:4031396-4031418 CTTAGGTAAATACCTAGGAGTGG + Intronic
1078224152 11:9377010-9377032 CTCTGGTAAATAGCTAGGAGTGG - Intergenic
1078403246 11:11045842-11045864 CTCAGGGAAATCTCAAGGACTGG + Intergenic
1078437481 11:11337577-11337599 GACAGAGAGATATTTAGGAGGGG + Intronic
1079592317 11:22194937-22194959 CTCGGGTATATATCTAGGAGTGG + Intronic
1080325497 11:31067529-31067551 CATAGGTATATAACTAGGAGTGG - Intronic
1081291220 11:41328041-41328063 CACAGGGAACTACCTGTGAGAGG - Intronic
1081532158 11:43969577-43969599 CACAGGGAAAAAGGAAGGAGGGG - Intergenic
1082933340 11:58631635-58631657 CAGAAGGAAATATCAAAGAGGGG + Intergenic
1085452872 11:76647201-76647223 CTTGGGGAAATATCTAGGAGTGG - Intergenic
1086015762 11:82165624-82165646 CACAAGGTAATATCTAGATGAGG - Intergenic
1086522610 11:87687583-87687605 CACACAGAAATATTTAGGTGTGG - Intergenic
1088029212 11:105225674-105225696 AGCAAGCAAATATCTAGGAGGGG + Intergenic
1088401005 11:109422656-109422678 CACAGGGAAATGGGGAGGAGGGG + Intronic
1090225574 11:125070195-125070217 CACAGGGGAAGATCGAGGTGTGG - Intronic
1090733201 11:129589438-129589460 CGGATGGAAATAGCTAGGAGAGG + Intergenic
1091180816 11:133602816-133602838 CTCAGGCAAATACCTAGGAGTGG + Intergenic
1091502145 12:1028641-1028663 CGAAGGGAAAAATCTAGGAAAGG - Intronic
1093692341 12:22122357-22122379 CATAGCAGAATATCTAGGAGGGG - Intronic
1093839942 12:23885166-23885188 CAGAGGGAAAGGTCTAGTAGTGG + Intronic
1093969379 12:25360940-25360962 CACAGGGAAAGATCAAGGAGAGG + Intergenic
1094762735 12:33552499-33552521 CTCAGGTAAATATTTAGAAGTGG + Intergenic
1096333569 12:50735784-50735806 CACAAGGAGAAAGCTAGGAGAGG + Intronic
1097769233 12:63561782-63561804 CTTAGGGAAACACCTAGGAGTGG + Intronic
1098928397 12:76379860-76379882 CATGGGCAAATACCTAGGAGTGG + Intronic
1099531089 12:83782211-83782233 CATAATGAAATATCTAGGAATGG + Intergenic
1101182415 12:102233627-102233649 AACAGAGAAATCCCTAGGAGTGG + Intergenic
1102366337 12:112339071-112339093 TATAGGGAATTACCTAGGAGTGG - Intronic
1102881694 12:116490193-116490215 CTCAGGTATATACCTAGGAGTGG - Intergenic
1103037802 12:117670674-117670696 CAAAGGGAAATATCTGCGTGGGG - Intronic
1104643905 12:130483929-130483951 CTCAGGGACACATCTAGGCGGGG - Intronic
1108587775 13:51885742-51885764 CAAAGGGAAGTGCCTAGGAGGGG - Intergenic
1109876044 13:68405597-68405619 CTCATGGAAACAGCTAGGAGTGG - Intergenic
1110151105 13:72254458-72254480 CAGAGGGATAGATATAGGAGTGG + Intergenic
1110602188 13:77387782-77387804 CTTAGGGGAATATGTAGGAGTGG + Intergenic
1112089937 13:96072539-96072561 CAGAAGGAAAAATCTAGTAGAGG + Intergenic
1112232045 13:97598754-97598776 CATAGGTAAATATCTAACAGTGG - Intergenic
1112359015 13:98699619-98699641 CTAGGGTAAATATCTAGGAGTGG + Intronic
1112876117 13:104040897-104040919 CTCATGGAAAGAGCTAGGAGTGG - Intergenic
1113559117 13:111263716-111263738 CACAGTGAAATATCAGGAAGAGG - Intronic
1114721803 14:24890556-24890578 CACAGTAATATATCTAGGAGTGG - Intronic
1115911378 14:38259932-38259954 CACAGGGATTCATCTAGCAGAGG - Intergenic
1118097475 14:62553928-62553950 ATCAGAAAAATATCTAGGAGTGG - Intergenic
1118357617 14:65027669-65027691 AACAGGGAAAGAGGTAGGAGAGG - Intronic
1120369358 14:83613055-83613077 CAGAAGAAAATATCTAGAAGAGG + Intergenic
1120974513 14:90236942-90236964 CCCAGGTATATATGTAGGAGTGG + Intergenic
1122078608 14:99251744-99251766 CACAGGGTCATATCTGGGATGGG + Intronic
1122376135 14:101259787-101259809 CTCAGGCAAATACCTAAGAGTGG + Intergenic
1124473068 15:30005675-30005697 CTGAGGGAAATATCTTCGAGTGG + Intergenic
1125475493 15:40045328-40045350 GACAGGGCAAGATCTGGGAGTGG - Intergenic
1128204681 15:65840264-65840286 CTCAGGGTAATTTCTAGAAGTGG + Intronic
1128437580 15:67669932-67669954 CTTAGGTAAATATCTAGGAAGGG - Intronic
1129118951 15:73383303-73383325 CAAAGGAAAACATCTAGAAGTGG + Intergenic
1130048618 15:80465035-80465057 CACAGAGAAATCCCTAGTAGGGG + Intronic
1131447131 15:92509790-92509812 CAGAGGTATATACCTAGGAGTGG - Intergenic
1131801743 15:96076344-96076366 AAAAGGGAAATGTCGAGGAGCGG + Intergenic
1131905546 15:97138048-97138070 CACTAGGTAATATCTAAGAGTGG - Intergenic
1132226090 15:100142403-100142425 CACAGGGAAAGATATGGGAAGGG + Intronic
1133056961 16:3150181-3150203 CACAGGGACATGTCTGGGAGAGG - Intergenic
1135834601 16:25813720-25813742 CTTGGGTAAATATCTAGGAGTGG - Intronic
1135908114 16:26532403-26532425 CTTAGGTAAATATCTAGGAGAGG + Intergenic
1138450439 16:57091004-57091026 CCCGGGTAGATATCTAGGAGTGG + Intergenic
1139839117 16:69864061-69864083 CATGGGTAAATACCTAGGAGAGG + Intronic
1140489255 16:75320496-75320518 CACAGGGAAAAATCAAAGAATGG - Intronic
1140679134 16:77367111-77367133 CAGAGGTAAATGTCTAGGTGTGG - Intronic
1141518204 16:84560357-84560379 CACAGGGAACCTTCTAGAAGAGG + Intergenic
1142776718 17:2146015-2146037 CAAAGAGAAATATTTAGGAAAGG - Intronic
1144045858 17:11453987-11454009 CTTGGGTAAATATCTAGGAGAGG + Intronic
1145298987 17:21616975-21616997 GACAGGAAAAGATCTAGCAGTGG - Intergenic
1145351296 17:22086306-22086328 GACAGGAAAAGATCTAGCAGTGG + Intergenic
1146410545 17:32579988-32580010 CCTAGATAAATATCTAGGAGTGG + Intronic
1147418747 17:40311641-40311663 GACAGTGAAATATCTTGGAGGGG - Intronic
1147596568 17:41721868-41721890 CACAAGAAAATATCTGGGGGAGG - Intronic
1147762426 17:42807999-42808021 GAGAGGGAAAAATCTAGGATAGG + Intronic
1148882954 17:50745410-50745432 CATAGGAAAATATCAATGAGAGG - Intronic
1149827110 17:59838891-59838913 CAAAGGGAAATGACTAGAAGAGG + Intronic
1150835691 17:68562271-68562293 AAAAGAGAAATATCTAGGACAGG + Intronic
1152869661 17:82745739-82745761 CTCGGGTAAATACCTAGGAGGGG + Intronic
1153892393 18:9530082-9530104 CTTAGAGAAATACCTAGGAGTGG - Intronic
1155345123 18:24850110-24850132 CATAGGGAGATATGTGGGAGAGG - Intergenic
1156346089 18:36258275-36258297 CACAGAGAAATACCTAGCAGGGG - Intronic
1157010570 18:43643815-43643837 CCAAGGTATATATCTAGGAGAGG - Intergenic
1158169093 18:54576245-54576267 CTTGGGGATATATCTAGGAGTGG + Intergenic
1159750351 18:72293265-72293287 CACAGAGACATATATAGGAGGGG + Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161542364 19:4859774-4859796 CCCAGGGAAATGACCAGGAGGGG + Intronic
1164796287 19:31034905-31034927 CACAGTGATATATCTAGGAGGGG + Intergenic
1165338920 19:35196442-35196464 GACAGGGAGAAACCTAGGAGAGG - Intergenic
1165506967 19:36239268-36239290 CCCATGGAAATATGCAGGAGAGG - Intronic
1165708918 19:37995759-37995781 CACTGGGAAGTCTGTAGGAGGGG + Intronic
1167123846 19:47535871-47535893 CACACAGAAATATAGAGGAGTGG + Intronic
1202684051 1_KI270712v1_random:32640-32662 CAAAGGGAAATATGCAGTAGAGG - Intergenic
926346354 2:11949757-11949779 GTTAGGTAAATATCTAGGAGTGG - Intergenic
927548971 2:23980299-23980321 CTCAGGTATAAATCTAGGAGTGG + Intronic
929297758 2:40267871-40267893 CTCAAGGAAATATGTGGGAGGGG - Intronic
930613596 2:53570585-53570607 CATAGGTAAATACCTAGGATTGG + Intronic
930749862 2:54924117-54924139 CTTAGGTAAATATATAGGAGTGG + Intronic
930890902 2:56386516-56386538 CAGAAGGAAATATTTTGGAGAGG + Intergenic
931117177 2:59177528-59177550 TGCAGGGAAATATCTAAGATTGG - Intergenic
931322624 2:61186060-61186082 CACTGGTGAATATCTAGGATTGG + Intronic
931712161 2:64997798-64997820 CTTGGGTAAATATCTAGGAGTGG + Intronic
932629251 2:73324199-73324221 CAAATGAAAATATCTAAGAGAGG + Intergenic
933700445 2:85251661-85251683 CACAGGGAACTATCAAAAAGCGG - Intronic
934247667 2:90322212-90322234 CAAAGGGAAATATGCAGTAGAGG + Intergenic
934261656 2:91480389-91480411 CAAAGGGAAATATGCAGTAGAGG - Intergenic
934304693 2:91811368-91811390 CAAAGGGAAATATGCAGTAGAGG - Intergenic
934328564 2:92041382-92041404 CAAAGGGAAATATGCAGTAGAGG + Intergenic
934466937 2:94271888-94271910 CAAAGGGAAATATGTAGTAGAGG + Intergenic
935034056 2:99351458-99351480 CTTAGGTAAATACCTAGGAGTGG + Intronic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
939703439 2:145421845-145421867 CACAGCTAAATGTCTAGGAGAGG + Intergenic
940267419 2:151853783-151853805 CTCTGGGAAAAATCTAGGATGGG - Intronic
940501437 2:154499186-154499208 CTTAGATAAATATCTAGGAGTGG - Intergenic
941252309 2:163181216-163181238 CACAAAGTAATATCTAGTAGAGG - Intergenic
943128672 2:183828657-183828679 CTTAGATAAATATCTAGGAGTGG - Intergenic
944491128 2:200258951-200258973 GACAGGAAAATATCTGTGAGGGG - Intergenic
945187888 2:207158042-207158064 CCCAGGGAAATATCTGGAGGTGG + Intronic
946135334 2:217641870-217641892 CAAGGAGAAAGATCTAGGAGAGG - Intronic
947849825 2:233276845-233276867 CACAGGGAAATTTCTAATACTGG - Intronic
1168963152 20:1882339-1882361 CCCAGGGAAATATCTAGAAGGGG + Intergenic
1172326558 20:34040149-34040171 CACAGAGAATTATTTAGAAGAGG + Intronic
1173379462 20:42526495-42526517 CACAGAGAAGTATCAAGCAGAGG - Intronic
1176587002 21:8596747-8596769 CAAAGGGAAATATGCAGTAGAGG - Intergenic
1180121711 21:45755412-45755434 CATAGGTAAATACCTAGGAGTGG + Intronic
1180269831 22:10573744-10573766 CAAAGGGAAATATGCAGTAGAGG - Intergenic
1180588079 22:16911119-16911141 CAAAGGGAAATATGCAGTAGAGG + Intergenic
1180732670 22:17993795-17993817 GAGAGGGAAATATGGAGGAGGGG + Intronic
1181517419 22:23423117-23423139 GAGAGGGAAATATGGAGGAGGGG + Intergenic
1181955935 22:26588007-26588029 CTCAGGTATATTTCTAGGAGTGG - Intronic
1183322924 22:37176065-37176087 CGCAGGGAAATATCGGGGGGCGG + Intergenic
1183425497 22:37736989-37737011 CACAGGGAAATACAGGGGAGAGG - Intronic
949350747 3:3122739-3122761 CTCAGGTAAATATCTAGGAGTGG + Intronic
949718238 3:6958529-6958551 CCTGGGTAAATATCTAGGAGTGG + Intronic
950208462 3:11098037-11098059 CACAGATTAATAGCTAGGAGGGG + Intergenic
954170395 3:48797425-48797447 AACTGGGAAATAACTGGGAGTGG - Intronic
954434862 3:50490556-50490578 CACAGGAAGATATGTGGGAGTGG + Intronic
955004472 3:54956044-54956066 GACAGGGAAACATTAAGGAGGGG - Intronic
955729569 3:61970373-61970395 CACAGGGAAACATCTAAGGAGGG + Intronic
955935008 3:64094510-64094532 CTCAAGGAAATATAAAGGAGGGG - Exonic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
957432604 3:80131226-80131248 CTCGGATAAATATCTAGGAGTGG + Intergenic
957823000 3:85401877-85401899 CACAGGCAAACATCTTGCAGTGG - Intronic
958443082 3:94180069-94180091 CAAAGAGAAAAATTTAGGAGTGG - Intergenic
959175621 3:102905648-102905670 CTCAGGTAAATACCTAGGAATGG + Intergenic
961064543 3:123863838-123863860 CTTGGGTAAATATCTAGGAGTGG - Intronic
962322286 3:134401597-134401619 CAGAGGGAAATCTATAGGAAAGG - Intergenic
963055847 3:141185802-141185824 CACAAGGGAAGATCAAGGAGGGG - Intergenic
963361834 3:144283660-144283682 TTTAGGTAAATATCTAGGAGTGG - Intergenic
965168968 3:165235903-165235925 CTCAGGCAAATATCTAAGAGAGG + Intergenic
965815965 3:172637023-172637045 CACATAGAAATATCAAGGAATGG - Intronic
965972618 3:174580835-174580857 CTCAGGGAGATACCTAAGAGTGG + Intronic
966404658 3:179584172-179584194 CACAGGATAAAATCTAGCAGTGG + Intronic
967378098 3:188827957-188827979 CAGATGGAAATATTTAGAAGAGG - Intronic
967827754 3:193892138-193892160 CTCAGGCATATATGTAGGAGGGG + Intergenic
967871029 3:194229354-194229376 CACATGGAAACATCTAGGATAGG - Intergenic
968183265 3:196612946-196612968 CACACTGAAGTATTTAGGAGTGG - Intergenic
969163941 4:5288241-5288263 CTTAGGTATATATCTAGGAGTGG + Intronic
969392489 4:6900948-6900970 GACAGGCAAATGTCTAGGAGAGG + Intergenic
969457963 4:7311419-7311441 CTCGGGTAAATATCTGGGAGTGG + Intronic
969544284 4:7814408-7814430 CTCGGGTAAATACCTAGGAGTGG - Intronic
969934656 4:10668624-10668646 GACAGTGAAGTATCTGGGAGTGG + Intronic
970542571 4:17094554-17094576 CACAGAGAAGTATCTAGGGCTGG + Intergenic
970968411 4:21953618-21953640 AACAGGGAAAACTCGAGGAGGGG - Intergenic
973187551 4:47348538-47348560 CATAATGAAATATCTAGGGGAGG - Intronic
974283292 4:59827764-59827786 GAAAGGAAAATATCTAGAAGAGG + Intergenic
974666722 4:64971328-64971350 CACATGGAAAATTCTAGGAAAGG + Intergenic
975286402 4:72626424-72626446 CTCAGGAAAATATCTGAGAGTGG - Intergenic
975777083 4:77799028-77799050 CTTGGGTAAATATCTAGGAGTGG - Intronic
976284411 4:83357380-83357402 CAAGGGTAAATAACTAGGAGTGG + Intergenic
976852580 4:89565198-89565220 CTTAAGTAAATATCTAGGAGTGG + Intergenic
977676103 4:99749046-99749068 AGCAGGGCAAAATCTAGGAGAGG - Intergenic
978838947 4:113186538-113186560 CACGGGAAGATATCCAGGAGGGG - Intronic
979341221 4:119526424-119526446 CCCAGCAAAACATCTAGGAGAGG - Intronic
980862417 4:138515527-138515549 CTTGGGTAAATATCTAGGAGTGG + Intergenic
981416825 4:144503572-144503594 CTCAGGAAAATATTTAGGAAAGG - Intergenic
982195247 4:152905193-152905215 CTTAGGCAAATACCTAGGAGTGG + Intronic
982311886 4:153994818-153994840 CATAAGCCAATATCTAGGAGGGG + Intergenic
982362183 4:154530813-154530835 CACAGGTACATATCTGGGGGAGG + Intergenic
983412257 4:167416649-167416671 CACATGGAGATATCTGGGGGCGG - Intergenic
985138807 4:186817260-186817282 CTTGGGTAAATATCTAGGAGAGG + Intergenic
985712181 5:1435738-1435760 CCCAGGGAAGCATCCAGGAGGGG - Intronic
985712201 5:1435804-1435826 CCCAGGGAAGCATCCAGGAGGGG - Intronic
985712221 5:1435870-1435892 CCCAGGGAAGCATCCAGGAGGGG - Intronic
985712239 5:1435933-1435955 CCCAGGGAAGCATCCAGGAGGGG - Intronic
985712257 5:1435999-1436021 CCCAGGGAAGCATCCAGGAGGGG - Intronic
985712277 5:1436065-1436087 CCCAGGGAAGCATCCAGGAGGGG - Intronic
987685775 5:21198998-21199020 CACAAGGAAATACCTGGGATTGG + Intergenic
991314080 5:65279806-65279828 GATAGGGAAATATCTAAGAGAGG - Intronic
993444853 5:87998883-87998905 CTTAGGTAAATATCTAGGAGTGG - Intergenic
994128909 5:96201592-96201614 CATAGGGAAAAATGTAGGAGTGG - Intergenic
994168394 5:96631847-96631869 CTCAGGTATATATTTAGGAGTGG + Intronic
995758247 5:115535733-115535755 CTCAGGCACATACCTAGGAGTGG - Intronic
996723735 5:126655313-126655335 CATTGGGAAATAACTTGGAGGGG - Intergenic
996767630 5:127050198-127050220 GACAGGGAATTATCCAAGAGTGG + Intronic
996952420 5:129143389-129143411 AACAGGCACATCTCTAGGAGAGG - Intergenic
997704821 5:135938893-135938915 AACAAGGAAATAACTAGAAGTGG - Intronic
998479231 5:142447955-142447977 CTTAGGTAAATACCTAGGAGTGG + Intergenic
998542943 5:143000265-143000287 CTTAGGTAAATACCTAGGAGTGG - Intronic
998924157 5:147104078-147104100 CACTGAGATATATGTAGGAGTGG - Intergenic
999115412 5:149159014-149159036 CACAGGGAAATATCTAGGAGAGG - Intronic
1000259213 5:159569857-159569879 CCTAGGTAAATAACTAGGAGTGG + Intergenic
1003573212 6:7269365-7269387 CACATGGAAAAATCTAGGATGGG + Intronic
1003814671 6:9825168-9825190 TACAGAGAAATATCTGGAAGAGG - Intronic
1004068656 6:12276238-12276260 TTCAGGGAAATTTCTAGGAAGGG + Intergenic
1004215014 6:13694164-13694186 CACGAGTAAGTATCTAGGAGTGG - Intronic
1004300184 6:14450755-14450777 AACAGGGAGAAACCTAGGAGTGG - Intergenic
1004626137 6:17378976-17378998 CTCAAGTAAATACCTAGGAGTGG - Intergenic
1005752371 6:28895511-28895533 CTCCAGGAAATATCTAGGGGAGG + Intergenic
1006792699 6:36714267-36714289 CAGAGGGTGATATCTAGGGGTGG + Intronic
1007607959 6:43129967-43129989 CATAGGGCAATATCTGGGGGAGG - Intronic
1008097272 6:47351611-47351633 CACTGGGAAATCTGTAGGACAGG + Intergenic
1008243610 6:49143862-49143884 CATAGGTAAATATCAAGGACAGG - Intergenic
1008331388 6:50248612-50248634 GACAGTGAAATATCTAATAGTGG - Intergenic
1010744957 6:79550392-79550414 CTTAGGGAAAAATCCAGGAGTGG - Intergenic
1011029625 6:82907827-82907849 CTCAGGTACATATCTAGGAATGG - Intronic
1011056885 6:83214672-83214694 AACTGGTGAATATCTAGGAGTGG - Intronic
1011566304 6:88676886-88676908 CTTGGGTAAATATCTAGGAGGGG - Intronic
1011907053 6:92384572-92384594 CTCAGAGAAATACCTAGAAGTGG - Intergenic
1012397877 6:98820899-98820921 CACAAGGCAAGATCTAGAAGGGG - Intergenic
1013867489 6:114716252-114716274 CAGTGAGAAATGTCTAGGAGTGG + Intergenic
1014072092 6:117194533-117194555 CACTGGGAAATAGAGAGGAGAGG + Intergenic
1014198104 6:118581469-118581491 CAAAGGGAAATAACAAGCAGAGG + Intronic
1014272057 6:119347518-119347540 CACAGGGAAGTAGCTCAGAGAGG + Intronic
1014693127 6:124586680-124586702 CTTAGGAAAATATCTAGGAGTGG - Intronic
1014794939 6:125713977-125713999 CAGAGAGAACTATCAAGGAGTGG - Intergenic
1015099963 6:129465635-129465657 CACAGTGGAATCTATAGGAGTGG + Intronic
1015455543 6:133423187-133423209 AACAGGGAAAAATCTAGGAGGGG + Intronic
1016849470 6:148602113-148602135 CACACAGAAATATAGAGGAGTGG - Intergenic
1018734422 6:166676611-166676633 CACAGGGACACCTCCAGGAGGGG - Intronic
1020851220 7:13355792-13355814 CCTAGGTAAATACCTAGGAGAGG - Intergenic
1020868270 7:13592826-13592848 CACAGGGAAACTTCTGGAAGTGG - Intergenic
1022205448 7:28159234-28159256 CCCAGGGAAGTAACTGGGAGTGG + Intronic
1022367677 7:29741007-29741029 CTTAGGGAAACACCTAGGAGTGG - Intergenic
1022921717 7:35022942-35022964 GACAGGGAAATCTCTCCGAGGGG - Intronic
1022928504 7:35082860-35082882 CTTAGGGAAACACCTAGGAGTGG + Intergenic
1023017680 7:35983406-35983428 CACAATGAAATATCTAGAATAGG + Intergenic
1024865250 7:53898620-53898642 CACAAGGAAATAAGTAGGCGAGG - Intergenic
1027556925 7:79676414-79676436 CACAGTGACATATCTAGGTATGG - Intergenic
1027611271 7:80364030-80364052 CTTGGGTAAATATCTAGGAGTGG + Intergenic
1028564776 7:92217762-92217784 TTCAGGCATATATCTAGGAGTGG + Intronic
1029163996 7:98573192-98573214 CTCAGGTAAATACCTAGGAGTGG + Intergenic
1029824616 7:103176534-103176556 CTTAGGGAAACACCTAGGAGTGG + Intergenic
1030056804 7:105590416-105590438 CTCTGGGAAATACCTAGGAGTGG + Intronic
1030481029 7:110103940-110103962 CACAGGGAAATATGAAGAAGAGG + Intergenic
1030522367 7:110613928-110613950 CTTAGGTAAATACCTAGGAGGGG - Intergenic
1033551078 7:142448762-142448784 CACAGGTAAATATTCAAGAGAGG + Intergenic
1034212393 7:149375402-149375424 CAGAGCCAAATGTCTAGGAGAGG - Intergenic
1036170976 8:6484510-6484532 CCGAGGCAAATATCTGGGAGTGG - Intronic
1036202093 8:6778424-6778446 CTTAGGGAAATCTTTAGGAGAGG - Intergenic
1036779684 8:11637234-11637256 CAGAGGGAGATGTCTAGGACAGG + Intergenic
1037215941 8:16451023-16451045 CACTGGGGAATATCGAGGGGTGG + Intronic
1037638307 8:20720201-20720223 CAGAGGGAAGTATTAAGGAGAGG - Intergenic
1037891782 8:22627526-22627548 CCCAGGGACATATCTGGGAGGGG - Intronic
1039898185 8:41731084-41731106 CACAGGGAAAATTCTGGAAGTGG + Intronic
1039985103 8:42440619-42440641 TCCAGGGAAATATCTAGGAGTGG + Intronic
1041132866 8:54721406-54721428 CAGTGGGAAATAGCTAGCAGGGG + Intergenic
1042587979 8:70363434-70363456 CATAGGTAAATATCTAGGAGTGG - Intronic
1043129643 8:76445330-76445352 CACAAGTAAATAACTAGGAAAGG - Intergenic
1044713135 8:95076012-95076034 ACCAGGGCAATTTCTAGGAGAGG - Intronic
1045918621 8:107503213-107503235 CTCAGGAAAAGATCTAGAAGTGG + Intergenic
1050219960 9:3376325-3376347 CATGGGTAAATACCTAGGAGTGG - Intronic
1050866823 9:10511269-10511291 CTCAGATAAATACCTAGGAGTGG + Intronic
1050875301 9:10627131-10627153 CACAGCTGATTATCTAGGAGGGG + Intergenic
1053696987 9:40648692-40648714 CAAAGGGAAATATGCAGTAGAGG + Intergenic
1054308239 9:63447925-63447947 CAAAGGGAAATATGCAGTAGAGG + Intergenic
1054406975 9:64771920-64771942 CAAAGGGAAATATGCAGTAGAGG + Intergenic
1054440599 9:65257382-65257404 CAAAGGGAAATATGCAGTAGAGG + Intergenic
1054489809 9:65764542-65764564 CAAAGGGAAATATGCAGTAGAGG - Intergenic
1055900515 9:81229094-81229116 CATAGGTAGAAATCTAGGAGTGG + Intergenic
1056436967 9:86583872-86583894 CCCATGGAGATATCTGGGAGTGG - Intergenic
1056871487 9:90285466-90285488 CTTAGGGATATACCTAGGAGTGG - Intergenic
1057358684 9:94353733-94353755 CTAAGGTAAATACCTAGGAGTGG - Intergenic
1057649067 9:96903877-96903899 CTAAGGTAAATACCTAGGAGTGG + Intronic
1058079137 9:100683528-100683550 CCTGGGGAAATACCTAGGAGTGG - Intergenic
1058422567 9:104846513-104846535 CACAAGAAAATGTCTAGAAGTGG + Intronic
1058887864 9:109336333-109336355 CACTGGGAAATATTAAGAAGCGG + Intergenic
1059810278 9:117849137-117849159 CAAAGGGAAATAAGTGGGAGAGG + Intergenic
1060082720 9:120666635-120666657 CTCAGATAAATACCTAGGAGTGG - Intronic
1060166748 9:121423475-121423497 CTCAGACAAATACCTAGGAGTGG - Intergenic
1061641134 9:131957174-131957196 CTTGGGCAAATATCTAGGAGTGG - Intronic
1061991299 9:134160172-134160194 CACAGGTATATACCTAAGAGTGG - Intergenic
1202779441 9_KI270717v1_random:22351-22373 CAAAGGGAAATATGCAGTAGAGG + Intergenic
1203616960 Un_KI270749v1:74461-74483 CAAAGGGAAATATGCAGTAGAGG - Intergenic
1185814872 X:3145510-3145532 CACAAGGAGATATATAGGAGGGG - Intergenic
1186058020 X:5672276-5672298 AAAAGGGAAGTATCTAGAAGAGG - Intergenic
1186399931 X:9248342-9248364 CTTAGGTAAATACCTAGGAGTGG - Intergenic
1190096143 X:47482753-47482775 CACAGGGGTATATCGAGTAGGGG - Exonic
1194022279 X:88706215-88706237 CCCTGGCAAATATTTAGGAGTGG - Intergenic
1194397486 X:93403821-93403843 CCCATGAAATTATCTAGGAGGGG - Intergenic
1195021345 X:100831889-100831911 AACAGGGAAATTTATAGTAGTGG + Intronic
1195575728 X:106448350-106448372 CTCAGGTAAATATCTAAGAGTGG - Intergenic
1195597131 X:106704689-106704711 CACATGGAAACTTTTAGGAGAGG + Intronic
1195635642 X:107112521-107112543 CTAAGGTAAATATCTAGAAGTGG - Intronic
1197948666 X:131870719-131870741 CATAGGTAAATATCTAAGTGTGG - Intergenic
1200305050 X:155016419-155016441 CTTAGTTAAATATCTAGGAGTGG - Intronic
1200351830 X:155504671-155504693 CTAAGGTAAATACCTAGGAGTGG - Intronic
1200760125 Y:7030061-7030083 CTTGGGTAAATATCTAGGAGTGG + Intronic
1201194710 Y:11480637-11480659 CAAAGGGAAATATGCAGTAGAGG + Intergenic
1201266379 Y:12211101-12211123 CACAAGGAGATATATGGGAGGGG + Intergenic
1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG + Intergenic