ID: 999116425

View in Genome Browser
Species Human (GRCh38)
Location 5:149168150-149168172
Sequence CTAGTTCACCAGTTCTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999116425_999116427 -3 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116427 5:149168170-149168192 TAGAGAAGAGATGCGGTAGAAGG 0: 1
1: 0
2: 7
3: 16
4: 193
999116425_999116426 -10 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116426 5:149168163-149168185 GGTGAACTAGAGAAGAGATGCGG 0: 1
1: 0
2: 1
3: 23
4: 293
999116425_999116429 15 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116429 5:149168188-149168210 GAAGGCTACTGTGGTAGCCCAGG 0: 1
1: 0
2: 4
3: 36
4: 221
999116425_999116428 6 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116428 5:149168179-149168201 GATGCGGTAGAAGGCTACTGTGG 0: 1
1: 0
2: 1
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999116425 Original CRISPR CTAGTTCACCAGTTCTCTAT TGG (reversed) Intronic
902663719 1:17923018-17923040 CAAGTTCTCCAGATCTCTAGAGG + Intergenic
904059512 1:27697063-27697085 ATACTTCTCCAGCTCTCTATTGG - Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
1064079223 10:12294815-12294837 CTGGTCAACCAGTTCTCTATGGG + Intergenic
1064115948 10:12577640-12577662 CTAAGCCACCAGTTCTCGATTGG + Intronic
1067412325 10:46076063-46076085 CTTGTTCTCCAGTTCTCTAAGGG + Intergenic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1073858126 10:107701435-107701457 CCAGATCACCAGGTCTCTCTTGG + Intergenic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1084131703 11:67140820-67140842 TTAATTCACCAGTTATTTATTGG + Intronic
1084336912 11:68463785-68463807 CTAGTTCAAGAGTTCTCAGTTGG + Intronic
1085366754 11:75954744-75954766 CTATTTCACCAGATCTTTCTGGG - Intronic
1090991286 11:131819191-131819213 CTAGTTCAAAACTTCTCTACTGG + Intronic
1094212488 12:27907016-27907038 CTAGTTCCCCTCTTCTATATTGG + Intergenic
1096551545 12:52376882-52376904 CCAGTTCATCAGTTCATTATAGG - Intergenic
1096625505 12:52893107-52893129 TTACTTAACCAGTCCTCTATTGG - Intergenic
1097687744 12:62707042-62707064 CTAGGTGCCCAGTTTTCTATAGG + Intronic
1098324206 12:69284194-69284216 CGAGTTGACCATTTTTCTATTGG - Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1102804519 12:115767857-115767879 CCAGTTCACCATCTCTTTATTGG + Intergenic
1104838137 12:131805446-131805468 CTGATTCACCAGTTCTCTTCTGG + Intergenic
1106278340 13:28237430-28237452 CTGGTTCACAGGTTCTCTAGGGG - Intronic
1106887095 13:34198853-34198875 CTAGTCCACCCTTTCTCTAGAGG - Intergenic
1108299169 13:49056652-49056674 CCAGTTCACCTGTTTTCTACTGG + Intronic
1109240777 13:59884514-59884536 CTAATTCTTCAGTTCTCTATGGG + Intronic
1110120871 13:71879996-71880018 CTATTTCACCAGATCTCTTGGGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112916085 13:104552149-104552171 CAAGTTCACCAGTTTTCTGTGGG + Intergenic
1113529751 13:111014228-111014250 ATAGTTCACCTCTGCTCTATAGG + Intergenic
1118502278 14:66372897-66372919 CTAGTTCACCAGTTTGCAGTTGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1132510278 16:337450-337472 CTAGCTCACCTGTAGTCTATGGG - Intronic
1134395313 16:13857088-13857110 ATAGTTAACCAGTTCCCTATTGG - Intergenic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1136176683 16:28521958-28521980 CTGGTTCACCAGATCTCGAGAGG - Intergenic
1140537911 16:75727775-75727797 ATAGCTCACTAGTTCACTATGGG + Intronic
1156541764 18:37919026-37919048 CTACATCACTAGTTCTCAATGGG - Intergenic
1158027470 18:52917816-52917838 CTAGTTTAGCATTTCCCTATTGG - Intronic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
927336890 2:21935507-21935529 CTTATTCACCAATTCTCAATAGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929726326 2:44431826-44431848 CTAGTTCCCCATTTCCCAATGGG - Intronic
930402890 2:50913253-50913275 CTAGTTCACAAGTTAGCCATAGG - Intronic
931896910 2:66742601-66742623 CTAATTCACCAGATATCTCTTGG - Intergenic
931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG + Intergenic
932730527 2:74218490-74218512 ATAGATCTCCAGTTTTCTATAGG + Exonic
933425300 2:82103652-82103674 GTAATTCTCCAGTTTTCTATTGG - Intergenic
935582287 2:104766986-104767008 CCAGTTAACCAGTTCTCAGTTGG + Intergenic
937639451 2:124194999-124195021 CTATTTGGCCAGTTTTCTATTGG - Intronic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
946447830 2:219754812-219754834 CTAGTCCACAAGGTCTCTCTGGG + Intergenic
947279627 2:228436220-228436242 CTAGTTAAACAGTTCTCTACTGG + Intergenic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1169716177 20:8621027-8621049 CTAGTTGATGAGTTCTTTATTGG - Intronic
1171288438 20:23964424-23964446 CTAATTCAACAGTTATCTAAAGG - Intergenic
1179062508 21:37992134-37992156 ATTGTTCACCAGCTCTCCATGGG + Intronic
955091213 3:55752455-55752477 CTGGTTTACCAGCGCTCTATTGG + Intronic
959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG + Intronic
959425579 3:106183608-106183630 CTAGTGCACCATTTATCAATCGG + Intergenic
961431366 3:126886233-126886255 CTGATTCACAAGTTCTCTTTTGG + Intronic
963677845 3:148335242-148335264 CTAGGTCACCAATTCTGTTTGGG - Intergenic
966474792 3:180331703-180331725 CTAGCTCTCCTGTTCTCTGTTGG + Intergenic
966825500 3:183961719-183961741 TTAGTTCAGTAGTTCTCTACAGG + Intronic
972942281 4:44210952-44210974 GAAGTTCACCAGTCCTCTAGAGG + Intronic
977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG + Intergenic
979798223 4:124874151-124874173 CAAATTCCCCAGTTCTCTCTTGG - Intergenic
979846539 4:125520293-125520315 CTGCTTCTCCAGTTCTCTCTCGG + Intergenic
980431833 4:132710340-132710362 ATAGTTCATCAGTTCGCTAGAGG - Intergenic
981917113 4:150046547-150046569 CTAGTTCCCCAGTCCTATTTTGG - Intergenic
982033522 4:151324743-151324765 CGAGCTCACCAGTTTTCTGTAGG - Intronic
986007692 5:3681867-3681889 CTAGGTCCCCAGTTCTCTCCTGG + Intergenic
987623819 5:20371292-20371314 ATGGATCAACAGTTCTCTATTGG + Intronic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
990629846 5:57656274-57656296 CTAATTCACTAATTCTCTAAAGG + Intergenic
991713130 5:69427822-69427844 CCACTGCACCTGTTCTCTATTGG - Intronic
995473976 5:112529815-112529837 CCAGTTCACCCGTTCTCTCCAGG + Intergenic
998782662 5:145675623-145675645 CCACTAAACCAGTTCTCTATTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000968227 5:167684971-167684993 CTAGACCACCAGCTCTCAATTGG + Intronic
1001192964 5:169647592-169647614 CAAGCTCACCAGTTCTCCCTGGG + Intronic
1005443989 6:25902266-25902288 CTAGTTCCTCATTTCTCTCTTGG + Intergenic
1005720446 6:28596219-28596241 TTATTTAACCAGTTCTCTGTTGG - Intronic
1008259538 6:49347806-49347828 TTAGACCACCACTTCTCTATTGG - Intergenic
1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG + Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1015470984 6:133606174-133606196 TAAGTTAACCAGTCCTCTATTGG - Intergenic
1015701841 6:136044623-136044645 GTAGATTACAAGTTCTCTATAGG - Intronic
1016200786 6:141405169-141405191 CTAATTCAGCAGTTATCTAAAGG + Intergenic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1024901812 7:54326759-54326781 CTAATTCACAAGCTCTATATTGG + Intergenic
1026325867 7:69309864-69309886 TTATTTCACCAGTCCTCTCTTGG - Intergenic
1030014621 7:105206236-105206258 CTAGTGCACTGGTTCTCAATGGG - Intronic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1034838212 7:154372033-154372055 CTAGGGCACCTGTTCTCTCTGGG - Intronic
1039017393 8:33166909-33166931 TTATTTAGCCAGTTCTCTATTGG - Intergenic
1039246851 8:35618184-35618206 CTAGTTCATCAGTCATCTGTGGG + Intronic
1039346817 8:36713733-36713755 CCAGTTCCACAGTTCTCTGTTGG + Intergenic
1041111890 8:54490840-54490862 CTAAGTCAACAGTTCTCTTTGGG + Intergenic
1041425810 8:57719084-57719106 CTAGGTTACCAGTTTTCTAAGGG - Intergenic
1042324056 8:67509554-67509576 CTCATTCACATGTTCTCTATTGG - Exonic
1045506624 8:102783149-102783171 CTGGTTCTCCAGTTCTCAACTGG - Intergenic
1047810654 8:128405312-128405334 CTACTTCTCCAGTTCTCTGGAGG - Intergenic
1048392797 8:133984165-133984187 ATTGATCACCAGTTCTCTTTGGG - Intergenic
1048487341 8:134860524-134860546 CAAGTTAAACAGTACTCTATAGG - Intergenic
1048957208 8:139546988-139547010 CCAGTTCACCATTTCTCCCTAGG - Intergenic
1053207648 9:36200471-36200493 CTAGTTCAACAGTTCCCAAGAGG - Intronic
1056586791 9:87932462-87932484 CTAGGTCACCAGGTCCCCATTGG + Intergenic
1056610087 9:88120479-88120501 CTAGGTCACCAGATCCCTACTGG - Intergenic
1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG + Intergenic
1057264005 9:93602125-93602147 CCAGTTCACGAGTTCTCTGAAGG + Intronic
1058451733 9:105103252-105103274 ATAGTTCATGAGTTCTCTAAGGG - Intergenic
1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG + Intronic
1187354611 X:18555277-18555299 CTAGTTCAATAGTTCTCCCTTGG - Intronic
1188713831 X:33435755-33435777 CTAGCTCACCTTTTCTTTATTGG - Intergenic
1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG + Intronic
1190856349 X:54298714-54298736 CTACTTCTCCAGTTCTCACTAGG - Intronic
1196596242 X:117548886-117548908 CAAGTTCACCAGTTCCCCATGGG - Intergenic
1197317702 X:124988436-124988458 CTAGTTCAAAAGTTCCCTTTTGG - Intergenic
1198982663 X:142417052-142417074 CTAGTCCAGCAGTTGTCTTTTGG - Intergenic