ID: 999116426

View in Genome Browser
Species Human (GRCh38)
Location 5:149168163-149168185
Sequence GGTGAACTAGAGAAGAGATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999116425_999116426 -10 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116426 5:149168163-149168185 GGTGAACTAGAGAAGAGATGCGG 0: 1
1: 0
2: 1
3: 23
4: 293
999116423_999116426 -8 Left 999116423 5:149168148-149168170 CCCCAATAGAGAACTGGTGAACT 0: 1
1: 0
2: 3
3: 14
4: 216
Right 999116426 5:149168163-149168185 GGTGAACTAGAGAAGAGATGCGG 0: 1
1: 0
2: 1
3: 23
4: 293
999116424_999116426 -9 Left 999116424 5:149168149-149168171 CCCAATAGAGAACTGGTGAACTA 0: 1
1: 0
2: 3
3: 10
4: 146
Right 999116426 5:149168163-149168185 GGTGAACTAGAGAAGAGATGCGG 0: 1
1: 0
2: 1
3: 23
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999116426 Original CRISPR GGTGAACTAGAGAAGAGATG CGG Intronic
900609645 1:3539143-3539165 GGTGCCCTGGGGAAGAGATGGGG + Intronic
901056360 1:6450316-6450338 GGGGAAGTGGAGAAGAGAGGAGG - Intronic
901556399 1:10034619-10034641 GATGAACCAGTGAAGAAATGTGG - Intronic
901705765 1:11071797-11071819 AGTGACCTAGAGAAGAGTTCTGG - Intronic
902477986 1:16698169-16698191 GGGGAAGTGGAGAAGAGAGGAGG + Intergenic
902726608 1:18340279-18340301 GATGAGCAAGTGAAGAGATGGGG + Intronic
903298937 1:22364265-22364287 GGTGATAAAGAGAAGAGAGGTGG - Intergenic
905514545 1:38552562-38552584 GGAGAAATGGAGAAGAGACGGGG - Intergenic
909047859 1:70731521-70731543 TGTGAACTAGAAAAGTCATGTGG - Intergenic
909132429 1:71754598-71754620 GGTGAGGTAGAGAAGAAAAGTGG - Intronic
909273031 1:73648743-73648765 GGTGAAGAAGAGCAGAGAAGAGG - Intergenic
909748664 1:79131820-79131842 GTTCACCTAGGGAAGAGATGCGG + Intergenic
912650943 1:111438809-111438831 GGTGGACCAGAGAACAGCTGTGG + Intergenic
913062863 1:115223872-115223894 TGTGAAATAGAGAAGAAACGTGG - Intergenic
915751389 1:158213758-158213780 GGAGAAGAAGAGAAGAGCTGTGG + Intergenic
917598345 1:176552216-176552238 AGAGAAGTAGAGAAGAGAAGAGG - Intronic
918438449 1:184541459-184541481 GGAGACCTAAAGAAGAGGTGAGG - Intronic
919895889 1:202009753-202009775 AGTGAACCAGAGATTAGATGGGG + Exonic
920207043 1:204299783-204299805 AGCCAACTAGAGAACAGATGGGG - Intronic
920910627 1:210213256-210213278 GGTGACCAAGAGAAGGGAGGGGG - Intergenic
921042823 1:211449941-211449963 GAGGAAGTAGAGAAGAGATAGGG + Intergenic
921234523 1:213112125-213112147 GCTGAAGTAGAGAGGAAATGGGG + Intronic
921480836 1:215662907-215662929 TGTGATATAGAAAAGAGATGGGG + Intronic
922170675 1:223151766-223151788 AGTGAACAAATGAAGAGATGAGG - Intergenic
922447112 1:225706935-225706957 GGTGGAGGAGAGAAGAGGTGGGG - Intergenic
922597379 1:226824350-226824372 GGTGGGCCAGAGATGAGATGAGG - Intergenic
923181443 1:231523796-231523818 AGTGTAATAGAGAAGAGAGGAGG + Intergenic
923648338 1:235846476-235846498 GGTGAACTAGAGAAATTTTGGGG - Intronic
923740536 1:236650909-236650931 CTTCAACTTGAGAAGAGATGAGG - Intergenic
924142600 1:241041481-241041503 AATGATCCAGAGAAGAGATGTGG + Intronic
924769046 1:247063241-247063263 CGTGAACTAGAGAGGAAAAGTGG + Intronic
924769862 1:247069855-247069877 GGGGGACTAGGGAAGAGGTGGGG + Intronic
1065244054 10:23739916-23739938 GGTGAAAGAGAGAAGAGTTACGG + Intronic
1067702765 10:48585622-48585644 GGTGCCAGAGAGAAGAGATGAGG - Intronic
1069917360 10:71795869-71795891 GGTGAGGCAGAGAAGAGATGAGG - Exonic
1072389980 10:94973530-94973552 GGGGAGGGAGAGAAGAGATGTGG - Intronic
1073236790 10:102023476-102023498 GGTGAACTATAGAAAATATGAGG - Exonic
1073993810 10:109293550-109293572 GGTGAGTGAGAGAAGAGAAGAGG - Intergenic
1075217221 10:120546386-120546408 GGTGCCACAGAGAAGAGATGAGG - Intronic
1078811003 11:14763070-14763092 AGTGAAATAGAAAAGAGAAGAGG + Intronic
1081068839 11:38583737-38583759 AATGAACTAGAGAAGAGAGAGGG + Intergenic
1081204862 11:40263382-40263404 GGTGAAGTAGAGAATGGATAAGG - Intronic
1081669938 11:44937236-44937258 GGTGAGCCAGAGAAGGGCTGAGG + Intronic
1084647683 11:70468712-70468734 GGTGAACTACAAAAGATATGAGG + Intronic
1085531456 11:77194540-77194562 GGAGTCCTAGAGAAGGGATGTGG + Intronic
1085984377 11:81768005-81768027 TCTGAATTAGGGAAGAGATGAGG - Intergenic
1086206506 11:84264485-84264507 TGTGGGCTAGAGGAGAGATGGGG + Intronic
1086474209 11:87152990-87153012 GGAGAACTGGAGAAGAGGTAAGG - Intronic
1088345406 11:108818853-108818875 GGTGTACTAGAGAATATATTTGG + Intronic
1088458426 11:110057441-110057463 GTTCAACTAGAGAAAAGATGTGG - Intergenic
1088598699 11:111457584-111457606 GGGGCACTGGAGTAGAGATGGGG - Intronic
1090066071 11:123504621-123504643 GGTGAAACAGAGAGGAGCTGTGG - Intergenic
1090382560 11:126337366-126337388 GGGGAAGTAGAGGAGAGCTGGGG + Intronic
1091996960 12:5001293-5001315 GGTGAACAAGAGAAGGTTTGGGG + Intergenic
1092688678 12:11081793-11081815 AGTGAAATAGAGAAGATATGGGG + Intronic
1095603465 12:44040132-44040154 GGGGGAGTTGAGAAGAGATGTGG + Intronic
1098304542 12:69089634-69089656 GGAGAACTAGAGAAGGGAGAGGG - Intergenic
1099286884 12:80724001-80724023 GGTGAAGTAGAGGGGAGAAGAGG - Intergenic
1099857682 12:88187955-88187977 GCTGAAATAGGAAAGAGATGAGG - Intronic
1100260355 12:92927742-92927764 GCTGAACTAAGGAAGTGATGGGG + Intronic
1101749757 12:107573703-107573725 GGAGACCCAGAGAAGAGTTGAGG + Intronic
1106146014 13:27050503-27050525 GGTCCACTAGAGAAGAAATGTGG + Intergenic
1106325509 13:28685050-28685072 GGAGAAGGAGAGAAGAGCTGTGG + Intergenic
1106601635 13:31192517-31192539 GGAGAACTTGAGTTGAGATGTGG + Intergenic
1107188710 13:37553708-37553730 GGAGAACTTGACAAAAGATGTGG - Intergenic
1107521769 13:41189504-41189526 GCTCAACTAGAGGAGATATGAGG + Intergenic
1108258586 13:48634045-48634067 AGTGACTTAGACAAGAGATGTGG - Intergenic
1109150251 13:58838165-58838187 AGTGAACCAGAGAAGAACTGAGG + Intergenic
1110047163 13:70844865-70844887 GGAGAAAGAGAGAAGAGCTGTGG - Intergenic
1111868861 13:93804868-93804890 CGTGAACTAGAGAACAGAAAGGG + Intronic
1112319468 13:98394043-98394065 GGTCCACTTGGGAAGAGATGGGG + Intronic
1114540116 14:23449082-23449104 TGGGAACTAGAGAAGAGAAAGGG + Intergenic
1117913737 14:60656850-60656872 GGTGAACTTGAGTAGAGGTAAGG - Intronic
1118695154 14:68377356-68377378 GAGGAACTAGAGAAGGTATGAGG - Intronic
1119387639 14:74267712-74267734 GGAGACCTAAAGAAGAAATGGGG - Intergenic
1119562592 14:75603038-75603060 GGTGGACAAGAGAAGGGATAAGG - Intronic
1121790215 14:96693642-96693664 GGTGAACTTGAGATGATTTGGGG - Intergenic
1121974958 14:98394444-98394466 TTTGCATTAGAGAAGAGATGAGG - Intergenic
1122060702 14:99134885-99134907 GGTGAGGCAGAGAAAAGATGTGG - Intergenic
1122321349 14:100857836-100857858 GGTGACCTAGAGAGAGGATGAGG + Intergenic
1123102801 14:105817153-105817175 GGTGACCCAGAGAAGAGCTGAGG - Intergenic
1202933318 14_KI270725v1_random:59989-60011 GGTGACAGAGAGAAGACATGCGG - Intergenic
1123955059 15:25326519-25326541 GTTGATCTTGAGGAGAGATGAGG + Intergenic
1124286026 15:28400941-28400963 GGTGAACTGGAGATGGGGTGGGG - Intergenic
1124296675 15:28510719-28510741 GGTGAACTGGAGATGGGGTGGGG + Intergenic
1124533119 15:30523241-30523263 GGTAAACTAAAGAAGGGCTGTGG - Intergenic
1124765537 15:32484403-32484425 GGTAAACTAAAGAAGGGCTGTGG + Intergenic
1124923413 15:34047935-34047957 GGTGCACGGGAGAAGGGATGGGG + Intronic
1125124620 15:36205715-36205737 GGTGAACTAGAGAACTGATGAGG + Intergenic
1126275904 15:46880593-46880615 TGTAAAATTGAGAAGAGATGAGG + Intergenic
1126280587 15:46943338-46943360 GGTGAGAGAGAGAAGAGTTGGGG - Intergenic
1126303511 15:47226849-47226871 TGTGAACCAAAGCAGAGATGTGG - Intronic
1126482936 15:49146881-49146903 GGAGAACTAGATAGGAGATAAGG - Intronic
1127592927 15:60445132-60445154 GGAAAAATAAAGAAGAGATGAGG + Intronic
1128107526 15:65055638-65055660 GATGGGGTAGAGAAGAGATGGGG - Intronic
1128291942 15:66484773-66484795 GGAGAAATAGAGCAGGGATGAGG + Intronic
1128434195 15:67629167-67629189 GGAGAGCTAGAGAAGTGACGGGG + Intronic
1129089792 15:73137049-73137071 GGTGAACTTAAGAAAAGAGGAGG - Intronic
1129102987 15:73283670-73283692 GGCCAACTAGAGAATAGATGTGG + Intronic
1131327222 15:91459514-91459536 TGTGAACTAGGGATGGGATGGGG + Intergenic
1131643185 15:94314026-94314048 GGTGAACTAGGGATGCCATGTGG + Intronic
1133628224 16:7592264-7592286 TGAGAACTTGAGAATAGATGAGG + Intronic
1134506060 16:14807947-14807969 GGTTAACTAGATAAAACATGTGG + Intronic
1134574490 16:15320823-15320845 GGTTAACTAGATAAAACATGTGG - Intergenic
1134727926 16:16435480-16435502 GGTTAACTAGATAAAACATGTGG + Intergenic
1134939510 16:18276346-18276368 GGTTAACTAGATAAAACATGTGG - Intergenic
1135125585 16:19806747-19806769 GGTGAATGGGAGAGGAGATGAGG + Intronic
1135873527 16:26175263-26175285 TGTGAACATGAGAAGAGAAGAGG + Intergenic
1137305462 16:47195173-47195195 AAAGAACTAAAGAAGAGATGAGG - Intronic
1137673643 16:50293187-50293209 GGAGGACAAGAGCAGAGATGGGG + Intronic
1137869816 16:51939256-51939278 TGTGAACTTGAGAAGAAATTAGG - Intergenic
1140020779 16:71236694-71236716 GGTGAAGGAGAAAAGTGATGTGG - Intergenic
1140851419 16:78938233-78938255 CGTGAACTAGAGGTGAGGTGGGG + Intronic
1140904415 16:79398191-79398213 GGTCAAAGAGAGAGGAGATGTGG - Intergenic
1140972324 16:80025249-80025271 GATCAACAGGAGAAGAGATGGGG + Intergenic
1142700507 17:1657308-1657330 TGTGAGGTAGAGAAGAGATTTGG + Intronic
1143381430 17:6498620-6498642 CCTCAACTAGAGAAGGGATGGGG + Intronic
1144060863 17:11582546-11582568 GGAGAAGGAGAGAAGAGCTGAGG - Intergenic
1144784975 17:17826564-17826586 GGTGAACTAGGGAGCAGTTGGGG - Intronic
1146572308 17:33963232-33963254 AGTGGACTAGAAATGAGATGGGG - Intronic
1146664401 17:34687835-34687857 GGTGAGCGAGAGAATAGAAGAGG + Intergenic
1146953482 17:36922279-36922301 GGTGAAGAAGAGGAGAGATGTGG + Intergenic
1147137233 17:38441400-38441422 GGGGAAAGAGAGAAGAGAGGAGG - Intronic
1147309783 17:39588566-39588588 GCTGAACTAGAGAATACCTGGGG + Intergenic
1148158217 17:45435489-45435511 GGAGAAATAAAGGAGAGATGGGG - Intergenic
1148220777 17:45860282-45860304 GGTGAGCTAGTGAAGAACTGGGG + Intergenic
1148399490 17:47342848-47342870 AGTGAACTAGAAAGTAGATGGGG - Intronic
1149579498 17:57739273-57739295 GCAGAAGTATAGAAGAGATGAGG - Intergenic
1150136928 17:62701209-62701231 GGAGAAGTAGAGGTGAGATGTGG + Intergenic
1150165834 17:62941631-62941653 GGTGAAATGGAGAAGAGGTGGGG + Intergenic
1151114843 17:71724182-71724204 GAAGAAGAAGAGAAGAGATGTGG + Intergenic
1152260559 17:79264664-79264686 GGTGAACTGGGGAAGCTATGAGG - Intronic
1153252407 18:3135842-3135864 GCTGGACTGGAGGAGAGATGAGG + Intronic
1153491467 18:5653402-5653424 GTTGAACTCGAGTAGAGATTTGG + Intergenic
1156056299 18:33008476-33008498 GGAGAATTAGAGAAGAACTGAGG - Intronic
1156688782 18:39681388-39681410 GGTGCACATGAGAAGAGAAGAGG + Intergenic
1157034587 18:43955676-43955698 TTTGAAATAGAGAAGAGAAGGGG - Intergenic
1157088589 18:44608224-44608246 TGTGAACAGGAGAAGAGGTGTGG + Intergenic
1158259897 18:55595001-55595023 GGAGATCCAGAGAAGAAATGAGG - Intronic
1163758077 19:19118827-19118849 GGTGACCCAGGGAAGGGATGTGG - Intergenic
1167214493 19:48155279-48155301 GGTGAGCTAGAGAGGAGAGTGGG - Intronic
1167499023 19:49835432-49835454 GGGGAACTAGTAAGGAGATGGGG - Intronic
1202712006 1_KI270714v1_random:23996-24018 GGGGAAGTGGAGAAGAGAGGAGG + Intergenic
926018028 2:9471696-9471718 GCCAAACTAGAGAAGGGATGAGG - Intronic
928144725 2:28762615-28762637 GGTGAATTTTAAAAGAGATGTGG + Intronic
928206918 2:29291009-29291031 TGTGAAATGGATAAGAGATGTGG + Intronic
928502874 2:31915652-31915674 GGTCAGCTGGAGAAGAAATGAGG + Intronic
929254457 2:39794354-39794376 GGTGCCCTAAAGAAGACATGGGG - Intergenic
929576793 2:43057175-43057197 CCTGAACTAGGGCAGAGATGGGG + Intergenic
929782651 2:44967076-44967098 GGTGAAGGAGAGAAGACACGGGG + Intergenic
930946570 2:57083775-57083797 GGAGAAGGAGAGAAGAGCTGTGG - Intergenic
931794417 2:65695702-65695724 GGTTACCAAGAGAAGAGAAGGGG + Intergenic
931829819 2:66039123-66039145 GGAGACCCAGGGAAGAGATGAGG + Intergenic
932093492 2:68826979-68827001 TGTGAAATACAGAAGAAATGGGG - Intergenic
932163760 2:69486946-69486968 GCTGAATTAGATAAGATATGAGG - Intronic
932342497 2:70975176-70975198 GGTGGTTTAGAGAATAGATGAGG + Intronic
932616847 2:73237457-73237479 GGTGGACCAGAGAAGACTTGGGG + Intronic
937359107 2:121216959-121216981 GGTTAACCACAGAAGAGAAGGGG - Exonic
937770339 2:125713461-125713483 GGAGAGGAAGAGAAGAGATGTGG - Intergenic
938091177 2:128435810-128435832 GGAGAAGGAGAGAAGAGAGGAGG + Intergenic
939994922 2:148911208-148911230 GGTGCAAAAGAGAAGAGAAGAGG + Intronic
940114179 2:150190121-150190143 GATGAAGTAGAGAAGAAAAGTGG - Intergenic
940271802 2:151899113-151899135 GTTGAACTGGAGGAGAGAGGAGG + Intronic
940641091 2:156345185-156345207 GGTTAACAAGAAAAGTGATGAGG + Intergenic
942103557 2:172610456-172610478 GGAGAACAAAAGAAAAGATGCGG - Intergenic
945157695 2:206856843-206856865 GGGGAATTAGAGAAGAGACCTGG + Intergenic
947454196 2:230238273-230238295 AGTGAACTGGAGAAGACATTTGG + Exonic
1168920269 20:1528341-1528363 GGTACACTGGAAAAGAGATGAGG - Intergenic
1169780219 20:9301578-9301600 GGTGAACCAAGGAAGAGATTTGG - Intronic
1169821104 20:9711001-9711023 GGTTAACGAGATAAGGGATGAGG - Intronic
1170887109 20:20350183-20350205 GGGGAAATAGTGAAGATATGGGG + Intronic
1171280090 20:23889055-23889077 ACTGAACTAGAGGAGACATGAGG + Intergenic
1171282690 20:23914338-23914360 GGAGACCAGGAGAAGAGATGAGG - Intergenic
1171287535 20:23954078-23954100 GGAGACCTGGAGAAGAGGTGAGG - Intergenic
1173525182 20:43726861-43726883 GGTGGATTAGAAGAGAGATGAGG + Exonic
1173688637 20:44941815-44941837 GGTTAACTAGTGAAGAGGGGAGG - Intronic
1175065227 20:56278610-56278632 AGTGGACTTGGGAAGAGATGTGG + Intergenic
1175791732 20:61744312-61744334 GGAGAAAGAGAGAAGAGAGGTGG + Intronic
1176594714 21:8682141-8682163 GGTGACAGAGAGAAGACATGCGG - Intergenic
1177826377 21:26088732-26088754 GATGAACCAGAAAAGAGTTGAGG + Intronic
1177991987 21:28047725-28047747 AGTGACCTAGACAAAAGATGAGG - Intergenic
1180277572 22:10659290-10659312 GGTGACAGAGAGAAGACATGCGG - Intergenic
1181726273 22:24813207-24813229 AGTAAACAAGAGTAGAGATGAGG + Intronic
1182657909 22:31904351-31904373 GGTGACCTAAGGAAGAAATGAGG + Intronic
1183251539 22:36733715-36733737 GGGTGACTAGAGAAGGGATGAGG - Intergenic
1184318633 22:43720712-43720734 GGTGTAGAAGAGAAGAGAGGGGG + Intronic
952446901 3:33389900-33389922 GCTGACCTGGAGAGGAGATGGGG - Exonic
952829801 3:37555015-37555037 GGGGAGATAGAGAAGAGAGGGGG + Intronic
952936253 3:38400524-38400546 GGTGAACGAGGGGAGAGAGGAGG + Intronic
953522229 3:43654693-43654715 GATGGACAAGAGAAGAGAAGTGG + Intronic
954543719 3:51415150-51415172 AGGGGACTAGAGAAGAGTTGTGG - Intronic
955870699 3:63435544-63435566 GTTGAAGCAGAGAAGGGATGTGG + Intronic
956811279 3:72866189-72866211 GGTGAACTAGTGAACAACTGGGG + Intergenic
957417961 3:79930066-79930088 GGAGAAGGAGAGAAGCGATGTGG + Intergenic
957665103 3:83217360-83217382 GGAGAAGGAGAGAAGAGCTGCGG - Intergenic
958987404 3:100798113-100798135 GGAGAAGCTGAGAAGAGATGTGG + Intronic
959636956 3:108585924-108585946 AGTGAAAGAGAGAAGAGAGGAGG + Intronic
961216862 3:125166318-125166340 GGTGGAAAAGAGACGAGATGGGG - Intronic
961780498 3:129317640-129317662 GGTGAGCTGGAGAAGAGGGGAGG - Intergenic
962972873 3:140421043-140421065 GGTGGAGTGGAGAAGAGATTTGG + Intronic
963260388 3:143186344-143186366 GTAGAAATAGAGAAGAGAAGAGG + Intergenic
963560238 3:146855427-146855449 GCAGAAGTGGAGAAGAGATGGGG - Intergenic
964668072 3:159195352-159195374 GGTGGCCAAGAGAGGAGATGGGG + Intronic
967481274 3:189976187-189976209 GTTTAACTAGAGAAAAGTTGTGG - Intronic
969050754 4:4371144-4371166 GGTGAAATACAGCAGAGATGTGG - Intronic
969663942 4:8546137-8546159 GGTGAACAAGTGAAGGGAAGGGG + Intergenic
969926505 4:10590621-10590643 GGTGAACTTAAAATGAGATGTGG - Intronic
969983438 4:11182109-11182131 GGTGAACTAGAAAAGAGGAAGGG - Intergenic
970621482 4:17824617-17824639 GCTGAACAAGAGAAGGGTTGAGG + Intronic
971453318 4:26820315-26820337 GGTGGAGAAGGGAAGAGATGGGG - Intergenic
972594455 4:40517436-40517458 GGTGATCTAGAAAGGAGTTGAGG - Intronic
972713503 4:41622562-41622584 GGTCACATAGAGAAGAGAAGTGG + Intronic
974197245 4:58591542-58591564 GCACAACTAGAGAAGATATGAGG + Intergenic
978183921 4:105835618-105835640 AGAGAAGGAGAGAAGAGATGCGG - Intronic
979544609 4:121925536-121925558 GGTGAAGTAGAGATGGAATGAGG + Intronic
980024161 4:127745487-127745509 GGAGAAAAAGAGAAAAGATGAGG - Intronic
981035373 4:140163431-140163453 GGTGACATTGAGAAGAGAAGTGG - Intergenic
981340380 4:143615488-143615510 GGAGAACCAGAGGAGAGAGGAGG + Intronic
983374921 4:166914288-166914310 GATGAAGTAAAGAAGAGATATGG - Intronic
984825022 4:183916351-183916373 AGTGATTTAGAGCAGAGATGCGG + Intronic
986329389 5:6706287-6706309 GGAGAAATAGAGAAGGGAAGGGG + Intergenic
987087350 5:14483319-14483341 GGTGAGGTAGAGAAGAGCAGAGG + Intronic
988054751 5:26080228-26080250 GAAGTACTAGAGAAGAGATGAGG - Intergenic
988828935 5:34968958-34968980 GGTGATGGAGAGAAGAGATAAGG + Intergenic
989084694 5:37663591-37663613 CGTAAACCAGAGAAGAGTTGGGG - Intronic
989098658 5:37804663-37804685 CGTGACCTAAAGAAGGGATGAGG - Intergenic
989333036 5:40281967-40281989 TGTGAAAGGGAGAAGAGATGGGG - Intergenic
990695793 5:58415732-58415754 GGTGAATTAGAGCACAAATGAGG + Intergenic
990831947 5:59969189-59969211 GGTGGACTTGTGAAGAGAAGTGG - Intronic
991570775 5:68051124-68051146 GGTGAATTAGACAAGAGATTAGG + Intergenic
993480071 5:88413688-88413710 GGAAAAATAGAGAATAGATGTGG - Intergenic
995386884 5:111598219-111598241 GGAGAAGTAGAGAAGAGCTTGGG - Intergenic
997322208 5:132987891-132987913 GCCGAACGAAAGAAGAGATGAGG - Intergenic
998179239 5:139924946-139924968 GGGGATCTCGAGAAGAGATGGGG + Intronic
998462542 5:142320452-142320474 TGTGAAAGAGAGAAGAGAAGAGG - Intronic
998710243 5:144816378-144816400 GGCGAACTTGTAAAGAGATGTGG + Intergenic
999116426 5:149168163-149168185 GGTGAACTAGAGAAGAGATGCGG + Intronic
1000027655 5:157374118-157374140 GGTGAACTAGAAAAGGGCAGTGG - Intronic
1001353202 5:170993113-170993135 TGTGATCTAGAGAAGGGAAGGGG + Intronic
1002024714 5:176389071-176389093 AGCGGACTAGAGAAGAGACGAGG + Intronic
1004490489 6:16110375-16110397 GGTGAATTAGATATGTGATGGGG + Intergenic
1004496880 6:16172770-16172792 AGTGAACTGGAGAAGTGATTTGG + Intergenic
1004535597 6:16497942-16497964 GCAGGATTAGAGAAGAGATGGGG + Intronic
1004640235 6:17508078-17508100 GGTGAGCTATAGAAGAGAGGAGG + Intronic
1005035063 6:21548009-21548031 TGTGAACTACACAAGAGGTGAGG + Intergenic
1005319602 6:24640281-24640303 AGGGAAATAGAGATGAGATGAGG + Intronic
1005758474 6:28946598-28946620 GGAGAACTTGATAGGAGATGAGG + Intergenic
1006264317 6:32905109-32905131 GGGAAGCTAGAGAAGAGAGGTGG + Intergenic
1006570926 6:35003677-35003699 GGTGAACTAAGGTAGCGATGAGG - Intronic
1007283660 6:40731298-40731320 AGTAAATTAGAGAAGAGATATGG + Intergenic
1009685239 6:66948921-66948943 TGTCAACTGGAGAAGAAATGGGG - Intergenic
1010359616 6:74977757-74977779 GGTGATCCAGGGAAGAGATGAGG - Intergenic
1010950616 6:82032972-82032994 TGTGAGCTAGAGAAGAAGTGAGG + Intergenic
1011448053 6:87464217-87464239 GGTGAACTTAACTAGAGATGTGG + Exonic
1011866334 6:91833196-91833218 GATGAACTAGACATGAGATTCGG - Intergenic
1012832174 6:104217992-104218014 GGTGAACTGGAAAAAAAATGTGG - Intergenic
1014817697 6:125953397-125953419 TGTGAAGGAGAGAAGAGCTGTGG + Intergenic
1015500164 6:133923320-133923342 GGTGAAGTAGTGCAGATATGTGG + Intergenic
1016182578 6:141165393-141165415 GGAAGACTAGAAAAGAGATGTGG - Intergenic
1016312011 6:142744245-142744267 GGTGAAAGAGAGAATAGATGAGG - Intergenic
1018427648 6:163698077-163698099 GGAGAACAAGGGGAGAGATGGGG + Intergenic
1019194510 6:170273316-170273338 GGTGAACTCGAGCTGAGCTGTGG - Intergenic
1020690292 7:11346672-11346694 GGTGAAGAAGAGAAGAGAGGAGG - Intergenic
1021425454 7:20495027-20495049 GGTCAACTGGAGATGAGTTGGGG - Intergenic
1021651452 7:22837467-22837489 GGAGACCTAGGGAAGGGATGAGG + Intergenic
1021815150 7:24439605-24439627 GGGGAAATAGAGGAGACATGTGG + Intergenic
1022351910 7:29574235-29574257 GGTGAAATAGAGAAATGAAGAGG + Intergenic
1022783116 7:33606446-33606468 GGTGAACTATGGAAGCTATGTGG + Intergenic
1024341039 7:48260148-48260170 GGGGAACTAGAGCAGTCATGTGG + Intronic
1025078482 7:55963379-55963401 TGTGAATTAGAGGATAGATGGGG - Intronic
1026139250 7:67691047-67691069 GGTGAACTGGAAGAGAGATTTGG - Intergenic
1028634071 7:92967460-92967482 GGAGAACCAGAGAAGAAATGTGG + Intergenic
1029956419 7:104644939-104644961 GGTGTAATAGAGAAGAGACCTGG - Intronic
1032561051 7:132893216-132893238 GGTGAACTAGACATGAGACATGG + Intronic
1033453424 7:141481682-141481704 GGTGACTTATAGAATAGATGAGG + Intergenic
1033459390 7:141531662-141531684 GATGAAGTAGAGAATATATGGGG - Intergenic
1033862987 7:145652220-145652242 GCTGAACTTGAGATCAGATGAGG - Intergenic
1034695406 7:153048796-153048818 TGGAAACTAGAGAAGTGATGTGG - Intergenic
1035318859 7:158015400-158015422 TGACAAATAGAGAAGAGATGGGG + Intronic
1035388440 7:158489790-158489812 GGGGAAACAGAGAAGAGACGCGG + Intronic
1035640201 8:1178956-1178978 GGTGAACTGGAGACGAGACCAGG - Intergenic
1036385263 8:8273772-8273794 CATAACCTAGAGAAGAGATGGGG - Intergenic
1036776872 8:11619024-11619046 AGTGGAATAAAGAAGAGATGGGG - Intergenic
1037337414 8:17805023-17805045 GATAAACTAGAGAAGAAATAGGG - Intergenic
1037351312 8:17960878-17960900 GATGAACTAATGAAGAGTTGGGG + Intronic
1040451067 8:47547729-47547751 GGTGAAATAAAGAAGATTTGTGG - Intronic
1041149104 8:54913251-54913273 GGAGTCCTAGAGAAGAGATGGGG - Intergenic
1044175945 8:89122354-89122376 GAGGACCTAGAGATGAGATGAGG - Intergenic
1044209154 8:89529648-89529670 AGCTAACTAGAGAAGAGTTGTGG + Intergenic
1047477052 8:125242672-125242694 GGTGAACTACAGAGTAGTTGTGG + Intronic
1047521555 8:125598986-125599008 GCTGAACTTGAGATGAGCTGGGG - Intergenic
1048692979 8:136989031-136989053 GGAGAAGTAGAGAGGAGTTGCGG - Intergenic
1050679243 9:8090693-8090715 GGTGAAGGAGAGAGAAGATGAGG - Intergenic
1052865560 9:33462817-33462839 GGGAAATCAGAGAAGAGATGTGG + Intronic
1053338524 9:37301217-37301239 GGTTAACTGGAGAAAAGATAAGG + Intronic
1053787482 9:41663006-41663028 GGGGAACTCCAGAAGGGATGGGG + Intergenic
1055645521 9:78358197-78358219 AGAGAACGAGAGAAGAGCTGCGG + Intergenic
1056006238 9:82274557-82274579 AGTTAACTAGAGAAGAGAGGAGG - Intergenic
1056530212 9:87479994-87480016 GGTGAACAAGAGAAGTGAAAGGG - Intergenic
1056721862 9:89078862-89078884 GGTGAACAAGAGAAGATAATAGG + Intronic
1059008896 9:110434977-110434999 GGAAAATTAGAGAAGAAATGAGG - Intronic
1059852949 9:118364106-118364128 GGAGAAGGAGAGAAGAGATGTGG + Intergenic
1061596654 9:131634828-131634850 GGTGAAGTTGGGAAGAGGTGGGG + Intronic
1186139006 X:6550984-6551006 GGTGACCTGGAGAAGGGGTGCGG + Intergenic
1186224798 X:7387123-7387145 GATGAACTAAAGATGAGAAGAGG - Intergenic
1187484313 X:19687697-19687719 AGTGAATGAGAGAAGAGAAGGGG + Intronic
1187741705 X:22363123-22363145 GGGGTAGTAGAGGAGAGATGAGG + Intergenic
1189955617 X:46274663-46274685 GGAGAGCAAGAGCAGAGATGAGG - Intergenic
1194424656 X:93721623-93721645 GGTTCACTGGAGAAGAGCTGAGG + Intergenic
1195252922 X:103065424-103065446 GGTGAAAAAGAGAAGAGAGCAGG - Intergenic
1195828715 X:109032334-109032356 GAGGAAGTACAGAAGAGATGTGG - Intergenic
1197963391 X:132030300-132030322 GGAGAAAAGGAGAAGAGATGAGG - Intergenic
1198041251 X:132854873-132854895 AGTGAAGGAGAGAAGAGGTGAGG - Intronic
1198442156 X:136673634-136673656 TGAGAACTAGAGAAGAGAGGGGG - Intronic
1199694502 X:150334453-150334475 GGTCTAGTGGAGAAGAGATGGGG - Intergenic
1199915192 X:152332000-152332022 GGTGAATTAAAGAAGATGTGTGG - Intronic
1200096369 X:153666008-153666030 GGAGAACAAGGCAAGAGATGTGG - Intergenic
1201253834 Y:12087955-12087977 GGAGAAAGAGAGAAGAGATAAGG - Intergenic