ID: 999116427

View in Genome Browser
Species Human (GRCh38)
Location 5:149168170-149168192
Sequence TAGAGAAGAGATGCGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 7, 3: 16, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999116423_999116427 -1 Left 999116423 5:149168148-149168170 CCCCAATAGAGAACTGGTGAACT 0: 1
1: 0
2: 3
3: 14
4: 216
Right 999116427 5:149168170-149168192 TAGAGAAGAGATGCGGTAGAAGG 0: 1
1: 0
2: 7
3: 16
4: 193
999116425_999116427 -3 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116427 5:149168170-149168192 TAGAGAAGAGATGCGGTAGAAGG 0: 1
1: 0
2: 7
3: 16
4: 193
999116424_999116427 -2 Left 999116424 5:149168149-149168171 CCCAATAGAGAACTGGTGAACTA 0: 1
1: 0
2: 3
3: 10
4: 146
Right 999116427 5:149168170-149168192 TAGAGAAGAGATGCGGTAGAAGG 0: 1
1: 0
2: 7
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999116427 Original CRISPR TAGAGAAGAGATGCGGTAGA AGG Intronic
904770962 1:32881206-32881228 GGGAGAAGAGATGGGGTGGAAGG + Intergenic
905041599 1:34964518-34964540 GAGAGGAGAGATGGGGCAGATGG - Intergenic
905504348 1:38465375-38465397 TAGAGAAAAGATGAGTTAGGAGG + Intergenic
906247308 1:44285506-44285528 TAGAGAAGAGGCCAGGTAGAAGG + Intronic
906248800 1:44295597-44295619 GAGAGAAGAGCTGCAGTGGAGGG + Intronic
906832637 1:49049330-49049352 TAGAGAAGAGCTGTGTTAAAGGG - Intronic
907855223 1:58296651-58296673 TAGAGAAGAAATGAGCTAGAAGG - Intronic
909024536 1:70467698-70467720 TAGAGAAGTGATGGGGCAGCAGG + Intergenic
909507755 1:76413165-76413187 TACAGAAGAGATGAGGGAGCTGG - Intronic
910149637 1:84126473-84126495 GAGAGAAGAGAGGCAGCAGAAGG - Intronic
910579225 1:88803137-88803159 GAGAGAAGAAATGAGGTGGAAGG + Intronic
910840365 1:91555350-91555372 TAGAGAAGAGAAGCTGGAGGGGG + Intergenic
911449717 1:98047513-98047535 TAGAGATGAGTTGTGGTAGTGGG - Intergenic
911977856 1:104524358-104524380 TAGAGGAGAGATGCCTGAGAGGG - Intergenic
912240532 1:107903135-107903157 TAGAGAAAAAATGAGGTAGCAGG + Intronic
913217106 1:116629854-116629876 AAGAGAAGAGATGCGTTAGAAGG - Intronic
915664751 1:157434354-157434376 GAGAGAAAAGATGAGGCAGATGG - Intergenic
915835875 1:159174054-159174076 TAGAGAAGAGGTGGGGAAGTGGG + Intronic
916303288 1:163300200-163300222 TGGAGAAAAGATGAGATAGAGGG + Intronic
916930427 1:169572840-169572862 GAAAGAAGAGATGAGGTGGATGG + Intronic
919943464 1:202304078-202304100 GGGAGAAGAGATGGGATAGAAGG - Intronic
920669960 1:207995960-207995982 TGGGGAAGAGATGCGGCAGGGGG - Intergenic
921074171 1:211686310-211686332 TAGGGCAGAGAGGCAGTAGAGGG + Intergenic
923187815 1:231591027-231591049 TGGAGAAGGGATGGGGTGGAGGG - Intronic
924206231 1:241713739-241713761 TAGAGAAGACATGAGTCAGATGG + Intronic
1063772841 10:9223652-9223674 TAGAGAATAGATGCGTTTGTTGG - Intergenic
1063916814 10:10891446-10891468 CAGAGAAGACATTCGGTAAAAGG - Intergenic
1063924279 10:10962115-10962137 GAGAGAAGAGAAGAGGGAGAGGG + Intergenic
1065183980 10:23155012-23155034 GAGAGAAAAGAAGCAGTAGAGGG + Intergenic
1065853112 10:29807250-29807272 GAGAAAAGAGAAGAGGTAGAAGG + Intergenic
1072208342 10:93224158-93224180 TAGAGAACAGATGGGGTAGAGGG + Intergenic
1073951991 10:108820342-108820364 TAGTGAAAATATGTGGTAGAAGG - Intergenic
1074773016 10:116745451-116745473 TGGAGAAGAGATGGTATAGAGGG - Intergenic
1075817737 10:125278614-125278636 TAGGGAAGAGAAGCGAAAGAAGG - Intergenic
1077108246 11:851070-851092 TGGAGCAGAGCTGAGGTAGAGGG + Intronic
1079473105 11:20799047-20799069 TAGAGAAGAGAAGCTGGAGAGGG + Intronic
1079855641 11:25600169-25600191 AAGAGAAGAGATGCTGGGGAGGG + Intergenic
1080255023 11:30281068-30281090 TAGAGAAGAAAAGAGGTAGAGGG + Intergenic
1083242782 11:61401932-61401954 AGGAGAAGAGATTCCGTAGAGGG - Intergenic
1087185070 11:95182337-95182359 GAGAGAAGAGGTGAGGTTGAAGG - Intronic
1088526257 11:110758987-110759009 TAGACAAGAAATGCAATAGAAGG - Intergenic
1088754405 11:112873771-112873793 TGCAGAAGAGAAGGGGTAGAGGG + Intergenic
1089269821 11:117294394-117294416 TTCAGTAGAGATGGGGTAGATGG + Intronic
1090273349 11:125403107-125403129 TAGAGAGGAGATGGGGTGAAGGG + Intronic
1091102071 11:132884161-132884183 GAGAGAAAATATGCAGTAGAAGG + Intronic
1092296773 12:7206913-7206935 CAGAGAAGAAATGAGGTAAAGGG - Intronic
1092458893 12:8669682-8669704 TAAAGAAGAGATAAGGGAGAAGG + Intergenic
1093778238 12:23102560-23102582 TGGAGAACAGATGAGTTAGAAGG - Intergenic
1096791858 12:54050327-54050349 TAGAAAGGAGATGGGGTGGAGGG + Intronic
1099426923 12:82534973-82534995 CAAAGAAGAGATGCGGCAGAAGG + Intergenic
1099935140 12:89116515-89116537 TAGAGAAGAGTTGAGGAACAGGG - Intergenic
1100725336 12:97402697-97402719 TAGAGAAGAGATGGGAGAGATGG - Intergenic
1104222640 12:126799881-126799903 TAGTGAAAAGATGCTTTAGATGG + Intergenic
1106550686 13:30768444-30768466 TTTAGTAGAGATGGGGTAGATGG - Intergenic
1106574189 13:30958831-30958853 AAAAGAAGAGATGGGGTTGAGGG - Intronic
1111235839 13:85406340-85406362 TTGAGAAGAGAAGCAGTAGCTGG - Intergenic
1112037024 13:95506478-95506500 TTGAGAAGAGAGGCAGTAGAGGG - Intronic
1113632235 13:111896317-111896339 TAAAGAAGAGATCCTGGAGAAGG - Intergenic
1115021884 14:28691745-28691767 TAGAGAAGAGTTGGTATAGATGG - Intergenic
1117685278 14:58246751-58246773 TAGACGAGAGAAGAGGTAGAAGG - Intronic
1117796040 14:59395385-59395407 GAGAGAAGAGAAGGGGAAGAAGG + Intergenic
1117904383 14:60569125-60569147 TAGAGTAGAGATGCTGGAGGAGG - Intergenic
1118728071 14:68644477-68644499 TTGAGAAAAGATGCTGCAGATGG - Intronic
1119589113 14:75868445-75868467 TAAAGAACAGATGGGGCAGAAGG - Intronic
1120942602 14:89963196-89963218 CAGAGAAGAGAAGAGGTAGATGG - Exonic
1123185378 14:106511583-106511605 TAGAGAAGGGATGTGGTTGTTGG + Intergenic
1125144899 15:36455684-36455706 TGGAGAAGAGAAGCAGAAGAGGG - Intergenic
1127657836 15:61071919-61071941 ATGAGTAGAGATGGGGTAGAGGG + Intronic
1128610890 15:69072379-69072401 CAGAGAACAGATGTGGTAGTGGG - Intergenic
1128678852 15:69631792-69631814 TAGAGAAGAGATGGTGTTAAAGG + Intergenic
1129150603 15:73685196-73685218 TGGAGAGGAGATGCGGGCGACGG + Intronic
1129383795 15:75184558-75184580 TAGAGGATAGATGGGGTGGAAGG + Intergenic
1130234844 15:82124520-82124542 TAGAGAAGAGAGGCTGTAAGAGG - Intergenic
1130401642 15:83560726-83560748 TCCAGAAGAGATGCATTAGATGG + Intronic
1132722726 16:1324694-1324716 AAGAGAAGAGACGTGTTAGAGGG - Intronic
1137441990 16:48505802-48505824 AGGAGAAGAGAAGCGGGAGAGGG + Intergenic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1146442702 17:32910942-32910964 GAGATAAGAGATGGGGAAGAGGG - Intergenic
1146836712 17:36117014-36117036 TGGAGAAGAGAAGAGGAAGAAGG - Intergenic
1147532377 17:41291915-41291937 TGGATAAGAGATGGGCTAGAGGG + Intergenic
1147949963 17:44101867-44101889 TAAAGAGGAGATGAGGTAGGGGG + Intronic
1149600170 17:57888407-57888429 CTGGGAAGAGATGGGGTAGAGGG - Intronic
1152510238 17:80781894-80781916 GAGAGAAGAGATCAGCTAGAAGG - Intronic
1153420478 18:4899531-4899553 TTGAGAGGAGATATGGTAGATGG - Intergenic
1156052952 18:32960391-32960413 TAGAGACTAGATGGGGAAGAAGG + Intronic
1161181708 19:2887821-2887843 TACTGAAGAGTTCCGGTAGATGG - Intergenic
1164305841 19:24003504-24003526 CAGAGAAGAGCTGCGGCTGACGG + Intergenic
1165367482 19:35377404-35377426 CAGAGAAAAGATGGGATAGAAGG + Intergenic
1166300308 19:41908958-41908980 AAGAGAAGAGATGGGGAAGGGGG - Intronic
1166531032 19:43543695-43543717 GAGAGAAGAAAAGAGGTAGAAGG + Intronic
1167907025 19:52669688-52669710 TAGAAAAGTGGTTCGGTAGATGG + Intronic
1168376707 19:55885961-55885983 AAGAGAAGAGATGAGATAGAAGG - Intergenic
1168579539 19:57543320-57543342 GAGGGAAGGGATGGGGTAGAGGG - Intronic
924964311 2:61072-61094 TAAAGAAAAGATGCAGTTGAGGG + Intergenic
925328971 2:3043637-3043659 AAGAGGAGAGACGGGGTAGAGGG + Intergenic
927054620 2:19357241-19357263 TAGGGAAGAGAAGCGCTGGAGGG - Intronic
929031050 2:37650143-37650165 AAGAGAACAGATGCAATAGAAGG - Intronic
929848310 2:45555906-45555928 AAGGGCAGAGATGCTGTAGATGG - Intronic
932875462 2:75446698-75446720 TAGAGAAGGGAGGAGGCAGAAGG - Intergenic
932905953 2:75751440-75751462 GAGAGAAGAGAAGAGGAAGAAGG + Intergenic
937278823 2:120703628-120703650 TAGAGAACTGATGAGGTAAAGGG - Intergenic
937449102 2:121986249-121986271 CAGAGAAGAAATGCTCTAGATGG - Intergenic
939057827 2:137384622-137384644 TTGAGAAGAGATGCTCTACAGGG + Intronic
940467877 2:154055613-154055635 TAGAGAAGAGATGCTGTTCTAGG + Intronic
942789551 2:179744243-179744265 TAGAGCACAGATGAGGTTGAAGG + Intronic
946328039 2:218994756-218994778 TAGAGAAAAGGGGAGGTAGAGGG + Intergenic
947202184 2:227623751-227623773 TAAAGCAGAGATGAGTTAGAAGG + Intronic
1172483118 20:35283361-35283383 TAGGGTAGAGATGTGGTAAAGGG + Intronic
1175036053 20:56003226-56003248 TAGAGAAAAGTTGCGGAGGAGGG - Intronic
1177199924 21:17942829-17942851 TAGAGGAGGGACCCGGTAGAAGG + Intronic
1178156333 21:29858352-29858374 TGCAGAAGAGATGAGGCAGAAGG - Intronic
1179044433 21:37831898-37831920 GAGAGAAGAAAGGCAGTAGAGGG + Intronic
1180818462 22:18808248-18808270 AAGAGAAGAGATGCGTTAGAGGG - Intergenic
1181204684 22:21242703-21242725 AAGAGAAGAGATGCGTTAGAGGG - Intergenic
1181833573 22:25583099-25583121 TAGGGAAGAGAGGGGGTAGGAGG + Intronic
1181999052 22:26905182-26905204 TAGAGAAGAGAGGAGAAAGACGG + Intergenic
1203222240 22_KI270731v1_random:52712-52734 AAGAGAAGAGATGCGTTAGAGGG + Intergenic
1203268590 22_KI270734v1_random:34102-34124 AAGAGAAGAGATGCGTTAGAGGG - Intergenic
949569055 3:5274118-5274140 GAGAGGAGAGATGAGGCAGAAGG + Intergenic
950622228 3:14215168-14215190 TAAAGAAGATTTGGGGTAGATGG + Intergenic
951697501 3:25461169-25461191 TATAATAGAGATGGGGTAGAGGG - Intronic
958452633 3:94293204-94293226 TTGAGAGGAGAGGCAGTAGATGG - Intergenic
958882806 3:99692018-99692040 TAGAGAAGAGTTGAGTTACAGGG + Intronic
959033064 3:101325410-101325432 TACAGAAGGGATGCCGTAAATGG + Exonic
959090802 3:101900590-101900612 CAGAGAAGACATGCTTTAGATGG + Intergenic
959521015 3:107322947-107322969 TAGAGAAAGGATGGGGTACAGGG - Intergenic
960196337 3:114772960-114772982 TGGAAAAGAGGTGTGGTAGAAGG + Intronic
960470545 3:118059615-118059637 CAGAGAAGATATGAGGTAGAGGG - Intergenic
960530791 3:118761974-118761996 TAGAGAAAAGGTGCTGTGGAAGG + Intergenic
961075441 3:123977683-123977705 GAGAGAAGAGAAGCCGAAGAAGG + Intronic
963260389 3:143186351-143186373 TAGAGAAGAGAAGAGGTCCAAGG + Intergenic
965645414 3:170875351-170875373 CAGAGAAGCCATGGGGTAGAAGG + Intergenic
965909389 3:173752932-173752954 AAGGGAAGGGATGGGGTAGATGG - Intronic
966712290 3:182982213-182982235 TAAAGAGGAGATGCAGGAGAAGG - Intronic
968719878 4:2193862-2193884 TACAGAAGAGATACAGAAGAGGG - Intronic
970464609 4:16310174-16310196 AAGAGAATAAAAGCGGTAGAAGG + Intergenic
970732635 4:19124994-19125016 TAGAGAATAGATATGGTAGTGGG + Intergenic
971643270 4:29162794-29162816 TAGGGAAGAGACCCTGTAGATGG - Intergenic
972205760 4:36770786-36770808 CAGAGAGGAGATGGGGAAGAGGG - Intergenic
973003347 4:44979453-44979475 TGGAGAAGACATCCGATAGAGGG + Intergenic
974478013 4:62407613-62407635 GGTAGAAGAGATGTGGTAGAAGG + Intergenic
975455374 4:74584368-74584390 GAGAGAAGAGAAGCAGTAGTAGG + Intergenic
975593421 4:76023134-76023156 GACAGAAGAGATGGGGAAGAGGG - Intronic
975909795 4:79253421-79253443 TAGAGAAGAGAAGAGGCTGAGGG + Intronic
976240142 4:82946837-82946859 TAGAGAAAAGATGATATAGATGG + Intronic
976819096 4:89184702-89184724 CAGAGAAGAGATGGGAGAGAAGG + Intergenic
976971798 4:91112773-91112795 TATAGAAGAGAGGCTGAAGATGG - Intronic
978379437 4:108111583-108111605 TAAAGAAAAAATGAGGTAGAGGG + Intronic
980079359 4:128327609-128327631 TAGAGAAGAGAAAAGATAGAAGG - Intergenic
982227843 4:153182117-153182139 GAGAGATAAGATGTGGTAGAGGG + Intronic
982696636 4:158609722-158609744 AAGAGCAGAGATGGGGTAGAAGG - Intronic
983712500 4:170736249-170736271 TGGAGGAGAGATGTGGAAGAAGG + Intergenic
986677805 5:10202233-10202255 TAGAAAGGAGATGTGGGAGAAGG + Intergenic
987155460 5:15084876-15084898 GAGAGTAGAGATGCTGCAGAAGG - Intergenic
987353705 5:17043944-17043966 TAGAAAAGAGAGGCAGAAGAGGG - Intergenic
989141582 5:38206825-38206847 GAGAGAGGAGATGGGGAAGAGGG - Intergenic
989528189 5:42476828-42476850 GTGAGAAGAGATGGAGTAGAAGG - Intronic
990117437 5:52405894-52405916 TAGAGCACAGATGAGGTAGAAGG + Intergenic
990205959 5:53429886-53429908 AAGACAAGAAATGCGGTGGAGGG + Intergenic
991452433 5:66767264-66767286 TAGATAAGAGATGGGGGAGCAGG + Intronic
993138696 5:84002883-84002905 TAGAGAAGAGCAGGGGTTGAAGG - Intronic
993602509 5:89945947-89945969 TAGAGAAGAGATTGGGTAGATGG + Intergenic
995616317 5:113968272-113968294 TAGAGAAGAAATGAGGCATAGGG - Intergenic
995942691 5:117602987-117603009 AAGAGAAGAGAGGAGGAAGAAGG + Intergenic
996339563 5:122421615-122421637 TTCAGAAGAGAAGCGGTAAATGG + Intronic
999116427 5:149168170-149168192 TAGAGAAGAGATGCGGTAGAAGG + Intronic
1000973691 5:167741720-167741742 TTGAGAAGAAAGGCGGAAGATGG - Intronic
1001868957 5:175133617-175133639 CAGAGTAGAAATGCGGGAGAAGG - Intergenic
1002296652 5:178235098-178235120 GAGAGCACAGAGGCGGTAGAGGG - Intergenic
1004466666 6:15891856-15891878 TAGAGGAGGGATTTGGTAGATGG - Intergenic
1004535598 6:16497949-16497971 TAGAGAAGAGATGGGGTCAAAGG + Intronic
1005175799 6:23043133-23043155 TAAAGAGCAGATGCAGTAGAAGG - Intergenic
1005983693 6:30856775-30856797 TATAGAAGAGATGAGGCAGATGG - Intergenic
1006526108 6:34606521-34606543 TGGAGAAGAGAAGGGGTAGGTGG - Intronic
1006804223 6:36777969-36777991 TAGAGAAGCGCTGCTGGAGAAGG - Intronic
1008153161 6:47981196-47981218 TAGAGAAGAGATGATTAAGATGG - Intronic
1008168092 6:48165958-48165980 TGGAGAAGACATGCTGTAGAGGG - Intergenic
1012526602 6:100185205-100185227 TGGAGAAGTGATGGGGAAGATGG - Intergenic
1015398011 6:132756724-132756746 TAGAGAAGAGTTTAGGTATAAGG - Intronic
1015691316 6:135926652-135926674 GAGAGAAGAGCAGGGGTAGAGGG + Intronic
1017056883 6:150444596-150444618 GAGTGAAGAGATGCTGGAGAAGG + Intergenic
1020628064 7:10607480-10607502 CAGAGGAGAGATGAGGCAGAAGG - Intergenic
1021381077 7:19967090-19967112 TAGAGAACAGATGTGTTTGATGG - Intergenic
1023136405 7:37057050-37057072 TATAGAAAAGATGAGGAAGAGGG + Intronic
1026578573 7:71595119-71595141 TAGAAAGGAGATGAGGAAGAGGG + Intronic
1028656020 7:93207928-93207950 GAGAGAAGAGAAGGTGTAGAAGG + Intronic
1032517976 7:132520965-132520987 GAAAGAAGAGAGGGGGTAGAGGG - Intronic
1033830345 7:145243887-145243909 TAAAGAAGAGATGATGTAGAAGG + Intergenic
1038505852 8:28084430-28084452 CAGAGAAAAGATGCTGTGGAAGG - Intergenic
1042662916 8:71175540-71175562 GAGAGAAGACAGGAGGTAGAAGG - Intergenic
1043093471 8:75934250-75934272 CAGAGATGAGATGAGGCAGAAGG + Intergenic
1047800568 8:128305401-128305423 AAGAGCAGAGATGTGGTACATGG + Intergenic
1049871176 8:144978376-144978398 TGGAGAAAATATGCAGTAGAAGG - Intergenic
1051336903 9:16073876-16073898 TAGAGAAGGGATTGGGAAGAGGG + Intergenic
1051348760 9:16178664-16178686 AAGATAAGAGATGTGGAAGATGG - Intergenic
1054962388 9:70983162-70983184 AAGAGAAGAGAGGTTGTAGAAGG - Intronic
1055613334 9:78045218-78045240 TAAAGAGGAGATGCTGTAAAGGG + Intergenic
1055976251 9:81957752-81957774 GAGAGAAGAGAGGAGGTAGGAGG - Intergenic
1058880632 9:109283017-109283039 TAGGGAAGAGAAGAGATAGAGGG + Intronic
1058966293 9:110042008-110042030 TGGAGAAGAGATGGTTTAGAAGG + Intronic
1059455084 9:114395326-114395348 TAGGGAAGAGGTGCGGCAGTTGG - Intergenic
1059727463 9:117023463-117023485 TAGAGGAGAGTTGGGATAGAAGG - Intronic
1185784094 X:2875209-2875231 TTGAGAAGAGCTGCCCTAGAAGG - Intronic
1186420789 X:9424406-9424428 TAGAGAAGTGAGGGGTTAGAAGG + Intergenic
1186923858 X:14310423-14310445 TCCAGAAGAGATGAGGGAGAAGG - Intergenic
1189197809 X:39166638-39166660 TTGAGAAAAGGTGAGGTAGAAGG + Intergenic
1190897114 X:54631361-54631383 TAGATAAGAAATGAGATAGATGG - Intergenic
1192773342 X:74216415-74216437 TAGAGAAGAAAGGCTGTAGTGGG - Intergenic
1194242223 X:91465213-91465235 TAGAGAACAAATGCGGTATGAGG + Intergenic
1195054681 X:101132414-101132436 TAAAGAAGAGCTGCGCTAGATGG - Exonic
1196003540 X:110811597-110811619 TAGGGAAAAGATCAGGTAGATGG + Intergenic
1196728466 X:118918572-118918594 GAGAGAGGAGAGGAGGTAGAAGG + Intergenic
1198012142 X:132568371-132568393 GGGAGAAGAGATGTGATAGAAGG + Intergenic
1199694500 X:150334446-150334468 TGGAGAAGAGATGGGGGAGCTGG - Intergenic
1201253831 Y:12087948-12087970 GAGAGAAGAGATAAGGGAGAGGG - Intergenic
1202106423 Y:21372608-21372630 TAGAGAAGAAATGCAGAAGTTGG - Intergenic