ID: 999116428

View in Genome Browser
Species Human (GRCh38)
Location 5:149168179-149168201
Sequence GATGCGGTAGAAGGCTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999116424_999116428 7 Left 999116424 5:149168149-149168171 CCCAATAGAGAACTGGTGAACTA 0: 1
1: 0
2: 3
3: 10
4: 146
Right 999116428 5:149168179-149168201 GATGCGGTAGAAGGCTACTGTGG 0: 1
1: 0
2: 1
3: 3
4: 73
999116423_999116428 8 Left 999116423 5:149168148-149168170 CCCCAATAGAGAACTGGTGAACT 0: 1
1: 0
2: 3
3: 14
4: 216
Right 999116428 5:149168179-149168201 GATGCGGTAGAAGGCTACTGTGG 0: 1
1: 0
2: 1
3: 3
4: 73
999116425_999116428 6 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116428 5:149168179-149168201 GATGCGGTAGAAGGCTACTGTGG 0: 1
1: 0
2: 1
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999116428 Original CRISPR GATGCGGTAGAAGGCTACTG TGG Intronic
907422731 1:54358036-54358058 GATGCTGCAGAGGGCTATTGAGG - Intronic
908890304 1:68839331-68839353 GATGAGTTAGAAGGCTCTTGTGG + Intergenic
916417629 1:164607472-164607494 GAGGCTGAAGAAAGCTACTGAGG + Intronic
916557715 1:165907678-165907700 GATGAGGTTGATGGCCACTGTGG - Exonic
919294722 1:195681613-195681635 AATGCTGTAGAAGATTACTGTGG - Intergenic
921862415 1:220053724-220053746 GATGAGCTAGAAAGCAACTGGGG - Intergenic
923303010 1:232660461-232660483 AATGCTGTAGAAGGCTCTTGTGG - Intergenic
1063188299 10:3669962-3669984 GTTGGGGTTGAAGGCTACAGAGG - Intergenic
1068690050 10:59905882-59905904 GGTGCGGGGGAAGGCTACTGTGG - Intronic
1069543653 10:69314032-69314054 CCTGCGGGAGAAGGCTGCTGAGG - Intronic
1077890837 11:6417141-6417163 GAATCAGAAGAAGGCTACTGAGG - Intronic
1078739044 11:14049524-14049546 GATGCAGTGGAAGGCTGGTGAGG - Intronic
1080930647 11:36806417-36806439 GATGCAGGAGAAGGCTGCAGAGG + Intergenic
1081750532 11:45507847-45507869 GATGAGGGAGGAGGATACTGGGG + Intergenic
1092515437 12:9206999-9207021 GATGAGGTAGAGGGATAGTGGGG + Intronic
1092998776 12:13976401-13976423 GATGGGGTAGAATGGCACTGAGG + Intronic
1105643190 13:22287388-22287410 GATGCAGAAGAAGGGGACTGGGG - Intergenic
1106786175 13:33110048-33110070 GAAGCTGTGGAAGGCTTCTGTGG - Exonic
1106965484 13:35060848-35060870 GAAGGGGTAGAGGGCTACAGTGG + Intronic
1112504750 13:99969132-99969154 GAGGCGGTGGATGGCTCCTGTGG - Intronic
1113422966 13:110184227-110184249 GATGGGGAAGAAGGCTTCTGGGG - Intronic
1117207615 14:53460318-53460340 GATGTGGAAGAAAGCTCCTGGGG + Intergenic
1121375635 14:93407770-93407792 GATGTGGTAGTAAGGTACTGGGG - Intronic
1129966240 15:79738410-79738432 GAAGAGGTAGCAGGCTTCTGGGG + Intergenic
1130521695 15:84666672-84666694 GATGCTGTTTCAGGCTACTGAGG + Intergenic
1133623161 16:7545557-7545579 GCTTAGGTAGAATGCTACTGCGG + Intronic
1143953433 17:10651583-10651605 GAGGTGGTGGAAGGCTACCGAGG - Exonic
1144194447 17:12876610-12876632 GATGGGTTAGAAGGATATTGTGG + Intronic
1148465090 17:47860140-47860162 GATGGAGTAGAAGCCTCCTGGGG - Intergenic
1155684701 18:28534387-28534409 GATGTAGTAGAAGACCACTGGGG + Intergenic
1159716170 18:71826099-71826121 GATGAGCTAGCAGTCTACTGGGG + Intergenic
1164555157 19:29245729-29245751 GATGAGGTCGAAGGATACCGAGG + Intergenic
926327189 2:11795487-11795509 GGTGCGGTAGGAGGCTTCTTGGG + Exonic
938488414 2:131740183-131740205 GAAGGGGTAGAGGGCTACAGTGG + Intronic
939663343 2:144918442-144918464 GATGTGGTAGCATGCAACTGTGG - Intergenic
944649862 2:201819139-201819161 GATGGGGTGGAGGGCTGCTGAGG + Intronic
945812873 2:214569683-214569705 GTGGCTGTAGAAGGCTAATGGGG - Intronic
946712768 2:222523163-222523185 GACCAGGTAGAAGGCTACAGTGG - Intronic
948003377 2:234587266-234587288 GATGGGGTAGAAGGCTACAGAGG + Intergenic
1172158086 20:32843726-32843748 CATGTGGTTGATGGCTACTGTGG + Intronic
1176103556 20:63375509-63375531 GATGGGGTACAGGGCTGCTGGGG - Intronic
1176103627 20:63375737-63375759 GATGGGGTAGAGGGCTGATGGGG - Intronic
1176103632 20:63375753-63375775 GATGGGGTACAAGGCTGATGGGG - Intronic
1178686213 21:34712802-34712824 GATTAGGCAGAAGGCCACTGTGG - Intronic
1184160180 22:42693091-42693113 GATGGGGTAGAAGGCCTCAGGGG + Exonic
1184661446 22:45967353-45967375 GAGGCGGTAGCAGGCTCCTAAGG - Intronic
952201642 3:31134978-31135000 GATGTGGGAGAAGGCAAGTGGGG + Intergenic
953631960 3:44625423-44625445 GCTGGGGGAGCAGGCTACTGAGG - Intronic
964532552 3:157684023-157684045 GAAAGGGTGGAAGGCTACTGAGG + Intergenic
971421852 4:26481141-26481163 AATGAGGTGGAAGGCTACAGCGG + Intergenic
986022983 5:3822079-3822101 TATGCTCTAGAAGGCCACTGTGG + Intergenic
994981413 5:106879106-106879128 TGTGAGGTAGAAGGCCACTGCGG + Intergenic
999116428 5:149168179-149168201 GATGCGGTAGAAGGCTACTGTGG + Intronic
1001083171 5:168681701-168681723 GATTTGGTAGAAGGCTGGTGTGG - Intronic
1003401286 6:5793258-5793280 GAGGCGGGAGAAGGCTGCTCAGG - Intergenic
1012180006 6:96140768-96140790 GATGCAGTAGGAGGTAACTGAGG - Intronic
1013131783 6:107240267-107240289 GGTGTGGTGGTAGGCTACTGTGG + Intronic
1019798691 7:3071841-3071863 AATGAGGGAGAAGCCTACTGGGG + Intergenic
1023363812 7:39443077-39443099 GCTGCGTGAGAAGGCTCCTGAGG - Intronic
1023696442 7:42852770-42852792 GATGGGGTAGAAAGCCTCTGTGG - Intergenic
1026137239 7:67674245-67674267 GAGGCTGAAGAAGGCTGCTGAGG + Intergenic
1027427889 7:78080526-78080548 GTTGTGGGAGAGGGCTACTGGGG - Intronic
1035104859 7:156433980-156434002 GATGGGAAAGAAGGTTACTGAGG + Intergenic
1044261952 8:90135367-90135389 GATACAGTAGAAGGATATTGTGG - Intergenic
1045077894 8:98590358-98590380 GATGGGGTAGAGGGCTTCCGAGG + Intronic
1045811949 8:106231925-106231947 GATCCTGTAAAAGCCTACTGAGG + Intergenic
1048993323 8:139774105-139774127 GACGCGGGCGAAGGCCACTGGGG + Intronic
1055719247 9:79153409-79153431 CATGCTGTAGAAGTCTATTGGGG - Intergenic
1059114423 9:111588167-111588189 GATGTGGTAGTGTGCTACTGTGG - Intronic
1059928134 9:119233130-119233152 GATTCTGCAGAAGGCTACTTTGG - Intronic
1060072838 9:120565335-120565357 GATGAGTTAAAAGGCTGCTGTGG - Intronic
1203454097 Un_GL000219v1:148909-148931 GATGCAGTAAATGGGTACTGAGG + Intergenic
1188306536 X:28566230-28566252 GATGTGATAGAAGGCCAATGAGG - Intergenic
1192773733 X:74220592-74220614 GATGAGTTAGAAGGATACTGTGG - Intergenic
1194985768 X:100488159-100488181 GATGACGTGGAAGACTACTGAGG + Intergenic
1196192278 X:112807343-112807365 TATGGGGTAAAAGGCAACTGTGG - Intronic
1196349533 X:114709845-114709867 AATGCAGTAGAAAGCTACTTTGG - Intronic
1196704927 X:118708817-118708839 GATAAGTTAGAAGGCTATTGTGG - Intergenic