ID: 999116429

View in Genome Browser
Species Human (GRCh38)
Location 5:149168188-149168210
Sequence GAAGGCTACTGTGGTAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999116424_999116429 16 Left 999116424 5:149168149-149168171 CCCAATAGAGAACTGGTGAACTA 0: 1
1: 0
2: 3
3: 10
4: 146
Right 999116429 5:149168188-149168210 GAAGGCTACTGTGGTAGCCCAGG 0: 1
1: 0
2: 4
3: 36
4: 221
999116425_999116429 15 Left 999116425 5:149168150-149168172 CCAATAGAGAACTGGTGAACTAG 0: 1
1: 0
2: 1
3: 11
4: 106
Right 999116429 5:149168188-149168210 GAAGGCTACTGTGGTAGCCCAGG 0: 1
1: 0
2: 4
3: 36
4: 221
999116423_999116429 17 Left 999116423 5:149168148-149168170 CCCCAATAGAGAACTGGTGAACT 0: 1
1: 0
2: 3
3: 14
4: 216
Right 999116429 5:149168188-149168210 GAAGGCTACTGTGGTAGCCCAGG 0: 1
1: 0
2: 4
3: 36
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999116429 Original CRISPR GAAGGCTACTGTGGTAGCCC AGG Intronic
902731219 1:18370124-18370146 GAAGGCTACTCTAATAACCCAGG - Intronic
903088147 1:20882701-20882723 GAAGGCTGAGGTGGGAGCCCAGG + Intronic
903225310 1:21891159-21891181 GCAGGGCACTGTGGGAGCCCAGG - Intronic
903892042 1:26576267-26576289 GGTGGCTACTGCAGTAGCCCAGG + Intergenic
904877729 1:33669503-33669525 GAAGGCAACTGGGGAAGCCCAGG - Intronic
905650440 1:39652912-39652934 GAAGGCAACTTTCGTAGCCATGG + Intergenic
908075680 1:60515192-60515214 GAATGCTAATGTGCTAGCTCAGG - Intergenic
909049980 1:70754758-70754780 GAAGTCTACTGTGGTAGAACAGG - Intergenic
913053113 1:115134126-115134148 GAAGGCTATTTTGGAATCCCAGG + Intergenic
913251132 1:116912566-116912588 TACGGCTACTGTCTTAGCCCAGG + Intronic
914195904 1:145448063-145448085 GGAGGCCACAGTGGTTGCCCAGG + Intergenic
914679518 1:149929344-149929366 GAAGAATACTGTTGTAGCTCTGG + Intronic
915002294 1:152604323-152604345 GATAGCACCTGTGGTAGCCCAGG - Intergenic
915202814 1:154245278-154245300 GAATGCTAATGAGGTAGCCCAGG - Intronic
915933345 1:160074399-160074421 GAAGGCTGCTGCAGTAGCCCTGG - Intergenic
916846369 1:168654821-168654843 GAAAGCTAATGTGATAGCCTTGG + Intergenic
917516353 1:175711618-175711640 GAAGGCTAGTGCAGTAGCCCAGG + Intronic
917714721 1:177722461-177722483 TCAGGCTACTGTGGTATGCCAGG - Intergenic
922875915 1:228939822-228939844 CTAGGGCACTGTGGTAGCCCAGG + Intergenic
923640202 1:235749903-235749925 GAGGACTATTGTGTTAGCCCAGG + Intronic
1063419916 10:5903885-5903907 CAAGGTTACTGTAGTAGTCCAGG - Intronic
1064368616 10:14730701-14730723 GGAGGCTACTGCAGTAGACCAGG + Intronic
1065721926 10:28635794-28635816 GGAGGCTACTGCCGTAACCCAGG + Intergenic
1065852413 10:29801803-29801825 GAAGGCTGCTGAGATACCCCAGG + Intergenic
1067029692 10:42871940-42871962 GAAGGTGACTGTGGCAGCTCTGG - Intergenic
1067838314 10:49655274-49655296 TGAGGCTGCTGTGGTTGCCCTGG + Intronic
1069056414 10:63849115-63849137 TAAGGCTACTCTGCTAGCACAGG + Intergenic
1069324698 10:67218776-67218798 GGAGGCTATTGTAGTAACCCAGG - Intronic
1069538936 10:69278645-69278667 GGAAGTTACTGTGGTAGTCCTGG + Intronic
1069935094 10:71910015-71910037 GAAAGCTACTGGGGAATCCCAGG + Intergenic
1070837867 10:79462134-79462156 GGAAGCTACTGTGGTAGTCCAGG + Intergenic
1071994981 10:91138970-91138992 GAAGGGTGCTGAGGTAGACCGGG - Intergenic
1072781758 10:98256268-98256290 GGAGGCTATTGTAGTAGCCCAGG - Intronic
1072924951 10:99609025-99609047 GGAGGCTGCTGTGGTAATCCAGG - Intergenic
1073020717 10:100441513-100441535 GGAAGCTAGTGTGGTAGTCCAGG - Intergenic
1073700019 10:105916182-105916204 GGAACCTACTGTGGTAGTCCAGG - Intergenic
1074862743 10:117524643-117524665 GAAGGCTGCTGGGGAGGCCCAGG - Intergenic
1077107533 11:848550-848572 GAGGGCTGCCGTGGAAGCCCCGG - Intronic
1077401018 11:2357467-2357489 GAAGGCTACTGTGGTGGGAAAGG + Intergenic
1078142431 11:8702060-8702082 GAAGGCAACTGCAGTGGCCCAGG - Intronic
1078498252 11:11841975-11841997 GAAGGCGGCTGTGGTAGCGGCGG + Exonic
1078888922 11:15535818-15535840 GAAGGCTCCTGCAGTGGCCCAGG - Intergenic
1080008101 11:27430677-27430699 GAAGGCTACTGTCGTGGTCCCGG - Intronic
1080029463 11:27645851-27645873 GAAGGCTGCTGTGATAGCCCAGG + Intergenic
1083323569 11:61862235-61862257 GAAGGCCACTCTGGTTGCCATGG + Intronic
1083901098 11:65643953-65643975 GAAGGCTATTGCAGTTGCCCAGG + Intronic
1084632964 11:70367600-70367622 GAAGGCTGCTAAGGCAGCCCAGG + Intronic
1084979005 11:72818825-72818847 GAAAGAGACTGTGATAGCCCAGG + Intronic
1085203619 11:74717179-74717201 GGAGGCTTGTGTGGCAGCCCAGG + Intronic
1086069178 11:82780586-82780608 GATGGCTAATGTGTTGGCCCTGG - Intergenic
1087250708 11:95896068-95896090 GAAGGCTAGTGTGGTTGAACTGG - Intronic
1087755699 11:102052805-102052827 GAAGGCTACTGTTGTAATCATGG - Intronic
1088545002 11:110950316-110950338 GAAGGCTACTGTCATAGTCCAGG + Intergenic
1088697515 11:112380853-112380875 GGAGACTACTGCAGTAGCCCAGG - Intergenic
1089276675 11:117341269-117341291 GGAAGCTACTGAGATAGCCCAGG - Intronic
1091171482 11:133523489-133523511 GAAGACTACTGTAGTAGTTCAGG - Intronic
1094110457 12:26856390-26856412 GAAGGCTAATGTAGTAGTCTAGG + Intergenic
1094439308 12:30457164-30457186 GAATACTGCTGTGGGAGCCCTGG - Intergenic
1094725871 12:33115617-33115639 GAAGGCTGCTGTGATAACCCAGG - Intergenic
1095638996 12:44465663-44465685 GAAGGCTATTGTAATAACCCAGG + Intergenic
1095658640 12:44701740-44701762 GAAGGCTATTGCAGTAGTCCAGG - Intronic
1097231135 12:57511915-57511937 GCAGTCTACTCTGCTAGCCCAGG - Intronic
1098072848 12:66694830-66694852 GATGTCTACTGTGGTAATCCGGG - Intronic
1098517673 12:71396279-71396301 GGAGGCTATTGCAGTAGCCCAGG - Intronic
1099992120 12:89734795-89734817 GAAGGTTACTGTCTTAGCCAGGG + Intergenic
1100209078 12:92382597-92382619 GAAGGTTACATTAGTAGCCCTGG + Intergenic
1101409252 12:104455768-104455790 GAAGGGAACTGAGGTTGCCCAGG + Intronic
1101650575 12:106673861-106673883 GAAGGCTACTGCAGTAGTCCAGG - Intronic
1102736276 12:115163383-115163405 GAAGACTAGTGTGGGACCCCAGG - Intergenic
1102956989 12:117065235-117065257 GGAGGCTGTTGGGGTAGCCCAGG + Intronic
1103117948 12:118353629-118353651 GCAGGCCCCTGTGGTAGTCCAGG + Intronic
1103137094 12:118516933-118516955 GGAGGCTGCTGTGGAAGTCCAGG - Intergenic
1104054611 12:125219858-125219880 GAAGGCTGCTGGGGGACCCCTGG - Intronic
1105485027 13:20819934-20819956 GAGGGCTAATGGGGTGGCCCAGG - Intronic
1105710801 13:23007244-23007266 TAAGGCTACTCTGCTAGCACAGG + Intergenic
1110441881 13:75535442-75535464 CAAGGCTACTGCGGTATTCCAGG + Intronic
1112327337 13:98450750-98450772 GCAGGTTCCAGTGGTAGCCCTGG + Intronic
1113789387 13:113019501-113019523 GAAGGTCACTGGGGTGGCCCTGG + Intronic
1116238598 14:42312492-42312514 TAAGGCCACTCTGCTAGCCCAGG - Intergenic
1116868082 14:50047539-50047561 GGAGGCTACTGTGAAAGCCCAGG + Intergenic
1117308992 14:54503476-54503498 GGAGGCTACTGTGGTAACCCCGG + Intergenic
1118224253 14:63884213-63884235 GAAGGCTTCTGTAGCAGCGCTGG - Intronic
1118772184 14:68949455-68949477 GACAGCTACTGTGGCAGGCCTGG + Intronic
1119538053 14:75419194-75419216 AAGGGCTTCTTTGGTAGCCCTGG - Intergenic
1120018541 14:79501819-79501841 GAAGGCTACTGTGATAGGGGTGG + Intronic
1120573724 14:86154086-86154108 GGAGGCTCCTGTAGTAGTCCAGG + Intergenic
1121251478 14:92502980-92503002 AAAGCCTGGTGTGGTAGCCCAGG - Intergenic
1121520524 14:94583275-94583297 GGAAGCTACTGGGGTAGCCCTGG + Intronic
1122240715 14:100365026-100365048 GCAGGCTAAGGTGGGAGCCCAGG + Intronic
1124492000 15:30163850-30163872 GGAGGCTACTGTGGTACTCCAGG - Intergenic
1124499597 15:30215579-30215601 GGAGGCTACTGTAATAGCTCAGG - Intergenic
1124743982 15:32323088-32323110 GGAGGCTACTGTAATAGCTCAGG + Intergenic
1124751537 15:32374467-32374489 GGAGGCTACTGTGGTACTCCAGG + Intergenic
1126586719 15:50296094-50296116 GAAGGCAATTGTGATAGTCCAGG - Intronic
1127418477 15:58780869-58780891 GAAGGCTACTAAGGTAGTCCAGG - Intronic
1130332961 15:82935477-82935499 GAAGGCTAGTGAGGTCACCCAGG - Intronic
1130537910 15:84800045-84800067 GAAGGCTACTGTTGTGGCCATGG + Intronic
1131776159 15:95801129-95801151 GGAGGCCACTGTGATAGCCTAGG - Intergenic
1132656717 16:1044551-1044573 CAAGGCTCCTCTGGGAGCCCAGG + Intergenic
1132943089 16:2518170-2518192 GTAGGCCCCTGTGGTGGCCCTGG + Intronic
1133337607 16:5016152-5016174 GGAGGCTGCTGTGTTTGCCCTGG + Exonic
1133976328 16:10601975-10601997 GAAGGCTACTGAGGTGACCCTGG - Intergenic
1134391374 16:13823334-13823356 GGATGCTACTGTGGTTACCCTGG - Intergenic
1136246802 16:28980960-28980982 GAAGGGCAGTGTGGGAGCCCTGG - Intronic
1136982845 16:35073824-35073846 TAAGGCTGCTCTGCTAGCCCAGG - Intergenic
1137961840 16:52888875-52888897 GGAGGCTACTGCAGAAGCCCAGG + Intergenic
1141425305 16:83940917-83940939 AAAGGCTGCTGTGGAAACCCCGG + Intronic
1145782349 17:27571430-27571452 GAAGGTTTCTATGGCAGCCCAGG - Intronic
1146963894 17:37008753-37008775 GAAGGCTAAGGTGGGAGCTCTGG + Intronic
1147559049 17:41497774-41497796 GAAGGCTCCTGGGGTAGCTTTGG + Intergenic
1149826839 17:59836299-59836321 GGAGGCTACAGTGAGAGCCCAGG - Intronic
1152245840 17:79184153-79184175 GAAGGCTTCTCTGGCTGCCCAGG + Intronic
1157227459 18:45880167-45880189 GAAGGCCACTCTGAGAGCCCTGG - Exonic
1157274221 18:46298768-46298790 GAAGGATACTGGGGTGACCCTGG + Intergenic
1158159317 18:54462163-54462185 GGAGGCTCTTGTGGTAACCCAGG - Intergenic
1159881727 18:73864755-73864777 GAAGGCTGCTGTAGGAACCCAGG - Intergenic
1164032149 19:21417329-21417351 TAAGGCTACTCTGCTAGCACAGG - Intronic
1164939131 19:32238278-32238300 CAAGGCGTCTGTGGTTGCCCAGG + Intergenic
1165730812 19:38143449-38143471 GAAGCCCACTGTGGTGGCCTGGG - Intronic
1167863623 19:52306066-52306088 TAAGACTACTCTGCTAGCCCAGG - Intronic
1168583898 19:57577539-57577561 GAAGGCTGCTGCAGTAGTCCAGG - Intronic
925058094 2:871033-871055 GGAGGCTACAGTGGGAGCTCAGG - Intergenic
927158860 2:20239844-20239866 GAAGGCTGCTGTGGTTCGCCCGG + Intergenic
927921689 2:26977545-26977567 GAAGGCAACTGTAGTGGGCCTGG - Intronic
930183305 2:48386100-48386122 TAAGGCCACTCTGCTAGCCCAGG + Intergenic
930681234 2:54258647-54258669 GGAGGCTACTGCAGTAACCCAGG + Intronic
931847481 2:66219634-66219656 GAAGGCTACTGTGGAGAACCTGG - Intergenic
931961421 2:67487355-67487377 GAAAACTATTGTGGTGGCCCTGG + Intergenic
932208682 2:69908411-69908433 GGAGGCTACTGCAGTAGTCCAGG - Intronic
932291866 2:70588103-70588125 GGCAGCTACGGTGGTAGCCCTGG - Intergenic
936774243 2:115953861-115953883 GAAGACTACTGTGTTAGGCAGGG + Intergenic
938492932 2:131775423-131775445 GAAGGCCACTGTGCCAGGCCTGG - Intergenic
938499539 2:131823218-131823240 GAAGGCCACTGTGCCAGGCCTGG + Intergenic
938551035 2:132382698-132382720 CAAGGCTCCTGTGGGAGCCCCGG + Intergenic
940826408 2:158417301-158417323 TAAGCATACTGTGGTGGCCCTGG + Intronic
941163001 2:162056096-162056118 GAAGGCTGCAGTGCTAGTCCAGG - Intronic
943164355 2:184299684-184299706 GAAGTGTACTGTGGAAGCACAGG + Intergenic
943368005 2:186983474-186983496 AAAGGCTATTTGGGTAGCCCCGG - Intergenic
945196885 2:207245187-207245209 GAAGGCTATTGTAGTGGCTCAGG + Intergenic
946085634 2:217168500-217168522 GAATTCTTCTGTTGTAGCCCAGG - Intergenic
946220127 2:218218291-218218313 GATTTCTTCTGTGGTAGCCCTGG + Intronic
946645192 2:221825900-221825922 AAAGGCTTCTTTGGAAGCCCAGG + Intergenic
946712765 2:222523154-222523176 GAAGGCTACAGTGGTAGAGGTGG - Intronic
947655306 2:231821521-231821543 GAAAGCTACTGTTCTAGGCCAGG - Intergenic
948980150 2:241490344-241490366 GCAGGCTCCTGTGGTCTCCCAGG + Intronic
1168833121 20:858273-858295 GGAGGCTACTGTAATAGTCCTGG + Intergenic
1169403638 20:5304923-5304945 TAAGGCTACTCTGCTAGCACAGG + Intronic
1169525172 20:6416574-6416596 GAAGGCTACATTGGGAACCCTGG - Intergenic
1169611214 20:7382190-7382212 GAAGGCTACTATGGTAGGAGTGG - Intergenic
1171180147 20:23085687-23085709 GAGGGCCCCTGTGGGAGCCCAGG - Exonic
1171239062 20:23550696-23550718 GTAGGCTCCTGTGGGAGTCCAGG - Intergenic
1176282144 20:64319538-64319560 GGAGGATACTGTGGTAGCAGTGG - Intergenic
1178156223 21:29857196-29857218 GAAAGCTATCATGGTAGCCCAGG + Intronic
1179343135 21:40531432-40531454 CAAGGCTACTGTGGGACCCTGGG - Intronic
1180876057 22:19175743-19175765 GGAGGCAGCTGTGGTAGGCCAGG + Exonic
1181300177 22:21874417-21874439 TAAGGATATTGTGGTAGCCTTGG - Intergenic
1181375503 22:22454728-22454750 GAAGGCTACTATGATAGCCTGGG + Intergenic
1182083298 22:27544040-27544062 GAAGGTCACTGTGGTAGGGCAGG + Intergenic
1182351428 22:29702241-29702263 GAAGGCTGCTGAGGTGTCCCAGG + Intergenic
949359905 3:3220665-3220687 GAAGGCTACTGTGGCAGGAGTGG - Intergenic
951812456 3:26715766-26715788 GTTGGCTCCTGTGGGAGCCCAGG - Intergenic
953021994 3:39120542-39120564 GAAGGCAACTCTGGGACCCCAGG + Intronic
953405357 3:42657148-42657170 GGAGGCTGCTGTGGTAGAGCCGG + Intronic
953921707 3:46956458-46956480 GAGGGCTACTGTGGTCACCAAGG + Intronic
954100434 3:48368141-48368163 TAAAGCTACAGTGGTAGCCATGG + Intergenic
955452145 3:59080621-59080643 GAAGGCAACGGCAGTAGCCCAGG - Intergenic
955589178 3:60515507-60515529 CAAGGCTACTGTCATAGACCTGG + Intronic
956997814 3:74848158-74848180 GCAGGCTACTGTAGTAATCCAGG + Intergenic
959198004 3:103210608-103210630 TAAGGCTACTCTGCTAGCCCAGG + Intergenic
959931170 3:111984784-111984806 GAAGGCTACTGTGATAGTCTAGG + Intronic
962095404 3:132287668-132287690 GGAGGCTACTGTAGTGGCCCAGG - Intergenic
962344338 3:134608470-134608492 GGAGGCTGCTGAGGCAGCCCAGG - Intronic
962722180 3:138186394-138186416 GAAGGCTATTGCTGTAGTCCAGG + Intergenic
966968310 3:185018089-185018111 TAAGGCTACTCTGCTAGCACAGG - Intronic
966978347 3:185106337-185106359 TAAGGCTACTCTGCTAGCACAGG + Intronic
969502228 4:7560030-7560052 GGAGGCTTCTGTGGAGGCCCTGG + Intronic
970838081 4:20434771-20434793 GAAAGCTAATATGGTAGCCCAGG + Intronic
971504118 4:27347809-27347831 GAATGCTACTGGGGTATCGCTGG - Intergenic
972556413 4:40186028-40186050 GAAAGCTACTGAGATTGCCCAGG + Intergenic
972954743 4:44375528-44375550 TTTGGCTACTGTGGAAGCCCAGG - Intronic
973889270 4:55353107-55353129 AGAGGCTACTGTGGTGGTCCAGG + Intronic
975352168 4:73358829-73358851 TAAGGCTACTCTGCTAGCCCAGG + Intergenic
975591043 4:76000170-76000192 GCAGGCTACTGAGGTAGCTCAGG + Intergenic
976805484 4:89041623-89041645 AAAGGATACTGTGGCAGGCCGGG + Intronic
977979994 4:103310036-103310058 GAAGGCTACTGTTAAAGTCCAGG + Intergenic
982572339 4:157065998-157066020 GAAGGCTACACAGGTAACCCAGG - Intergenic
982714972 4:158797380-158797402 GAAGGCTATTACGGTAGTCCTGG + Intronic
984060971 4:174988673-174988695 TAAGGCTACTCTGCTAGCCCAGG - Intergenic
984169745 4:176345427-176345449 TAAGGCTACTCTGCTAGCCCAGG + Intergenic
984313119 4:178090223-178090245 GAAAGCTACTGCTGTAGTCCAGG - Intergenic
984741046 4:183163305-183163327 GATGGCTACTCCGGCAGCCCAGG - Intronic
985873160 5:2575060-2575082 TGAGGCTACTGTGGAATCCCAGG + Intergenic
986210558 5:5667566-5667588 GAAGGCCAGTTTGGGAGCCCAGG - Intergenic
987366743 5:17155451-17155473 TGAGGCTACTTTGGTAACCCTGG - Intronic
987467895 5:18294457-18294479 GAAGGTGACTGTGGTAGTCAGGG + Intergenic
989008657 5:36844491-36844513 GAAGTTAACTGTGGTAGCCCAGG - Intergenic
989742527 5:44789729-44789751 TAAGGCTACTCTGCTAGCACAGG + Intergenic
995261700 5:110111790-110111812 GAAGGCAAATGTGGTGGTCCAGG + Intergenic
998037616 5:138930216-138930238 GAAGGCTAATGTGGAAGCTTTGG - Intronic
999116429 5:149168188-149168210 GAAGGCTACTGTGGTAGCCCAGG + Intronic
999644138 5:153701269-153701291 GGAGGCTACTGAGGCAGGCCTGG - Intronic
999653286 5:153788313-153788335 GAAGGCTAGTGGAGGAGCCCAGG - Intronic
1001187809 5:169593022-169593044 GAAGGCTACAGCAGTAGTCCAGG - Intronic
1001858321 5:175031982-175032004 GAAGGCTCCTGTGGTCCCCCAGG - Intergenic
1005260100 6:24049947-24049969 GGATGCTACTCTTGTAGCCCTGG + Intergenic
1005727609 6:28664926-28664948 GGAGGCTACTGTGGTAATCTTGG + Intergenic
1006189785 6:32200882-32200904 GATGGCTGCAGTGGGAGCCCTGG - Exonic
1006393824 6:33774026-33774048 GAAGGCTTGGGTGGTAGCTCCGG + Intronic
1006980013 6:38139869-38139891 GGAGGCTATTGCAGTAGCCCTGG + Intronic
1007448182 6:41923083-41923105 GGAGGCTACTGTGATAATCCAGG - Intronic
1009955488 6:70447895-70447917 TAAGGCTACTCTGCTAGCACAGG - Intronic
1010698852 6:79015722-79015744 GAAGGTTACTATGGTAGCTTGGG - Exonic
1011880391 6:92016917-92016939 GAAGGTTACTGTGATACCCTAGG - Intergenic
1013018117 6:106179831-106179853 AGAGGCTACTGTAGTAGTCCAGG + Intergenic
1013598072 6:111678979-111679001 GAAGGCTACTATAGAAACCCAGG - Intronic
1017597748 6:156047267-156047289 GAAAGTAACTGTGGCAGCCCTGG - Intergenic
1018789986 6:167140859-167140881 GAAAGCAGCTGTGATAGCCCAGG + Intergenic
1020835081 7:13139108-13139130 AAAGGTTAATGTGGTAGGCCTGG - Intergenic
1022098896 7:27157569-27157591 GAAGGTTTCTGGGGTAGGCCGGG + Intronic
1025713561 7:63932394-63932416 GGAGGCAGCTGTGGTAGCCCAGG - Intergenic
1026186794 7:68088281-68088303 GAGGGCTACTGTGTTAGACTTGG - Intergenic
1026382414 7:69812867-69812889 GGAGGCTACTGAGGCAGTCCAGG - Intronic
1027422716 7:78033076-78033098 GGAGGCCATTGTGGTAGCTCGGG + Intronic
1028658228 7:93235473-93235495 TGAGGCTACTGTGGTAATCCAGG + Intronic
1028780232 7:94727601-94727623 TAAGGCTACTCTGCTAGCCCAGG - Intergenic
1032268817 7:130385850-130385872 CAAGGCTGCTGTGACAGCCCTGG + Exonic
1032653448 7:133903356-133903378 AAAGGCCACAGTGGTAACCCAGG + Intronic
1033118916 7:138649759-138649781 CAAGGCTACTGCAGTAGACCAGG + Intronic
1033220282 7:139523072-139523094 GAAGGCTCCGGAGGGAGCCCTGG + Intergenic
1034246719 7:149650318-149650340 TAAGGCTACTCTGCTAGCCCAGG - Intergenic
1034846566 7:154451598-154451620 GGAGGCTGCTGTGGTTGCCTTGG - Intronic
1036583316 8:10099243-10099265 GTAGGCTGCTTTGGTGGCCCAGG + Intronic
1037394055 8:18423425-18423447 CAAGGGCACTGTGGAAGCCCTGG + Intergenic
1042384622 8:68159419-68159441 TAAAGCTACTGTGGAAGTCCCGG - Intronic
1042449989 8:68932955-68932977 GAAGGCTACTGTAGTAGTCCAGG + Intergenic
1043512589 8:80964448-80964470 GAATTATACTGTGATAGCCCAGG - Intergenic
1045934964 8:107668766-107668788 GAAGTCTTATGTGGTAGCTCTGG - Intergenic
1047391196 8:124452754-124452776 GGAGGCTTCTGTGGTTGTCCAGG + Exonic
1047772396 8:128039786-128039808 GGAGGCTATTGTGGTAATCCAGG + Intergenic
1049437507 8:142594581-142594603 GAGGGCTACAGTGGAAGCCTGGG + Intergenic
1049453358 8:142674779-142674801 GCAGGCTGCTGTAGTGGCCCAGG - Intronic
1049857571 8:144872729-144872751 TAAGGCTACTCTGCTAGCACAGG + Intergenic
1050446817 9:5732232-5732254 GGAGACTATTGTGGTAGTCCTGG + Intronic
1052017387 9:23484856-23484878 GAATGCTACTGAGGGAGCCAGGG + Intergenic
1053165092 9:35838948-35838970 TGAGGCTACTGTGGTAGCCCTGG - Intronic
1053236700 9:36461613-36461635 AAAGGCTACTGTGGCAGTTCAGG + Intronic
1054870205 9:70042401-70042423 GGAGGCCACTGCGGTATCCCAGG + Intergenic
1055114406 9:72591457-72591479 CAAGGCTATTGCAGTAGCCCGGG + Intronic
1056517904 9:87372273-87372295 TAAAGTTACTGTAGTAGCCCAGG + Intergenic
1059528267 9:115013309-115013331 GAAGGCTACTGTGATGTCTCAGG + Intergenic
1062698828 9:137888759-137888781 GGAGGCCACAGTGGTTGCCCAGG - Intronic
1187737371 X:22318519-22318541 GAGACTTACTGTGGTAGCCCGGG - Intergenic
1187919648 X:24188784-24188806 GAAGGTTATTGTGGTAGTCTAGG + Intronic
1188437056 X:30172871-30172893 GAACTCTACTGTGATACCCCAGG - Intergenic
1190280230 X:48924357-48924379 GGAGGCTACTGCAGTAGGCCAGG - Intronic
1190446193 X:50526782-50526804 GAAGGATCTTGTGGTAGCCCAGG + Intergenic
1192223418 X:69212482-69212504 GAAGGTTATTGTGGGACCCCTGG + Intergenic
1194536146 X:95107565-95107587 TAAGGCTACTCTGCTAGCCCAGG - Intergenic
1194729892 X:97440661-97440683 GAAAGCTATTGTGGTATCACAGG + Intronic
1197720221 X:129739927-129739949 GAAGGCTAGGGTGGGAGCGCTGG - Intronic
1201683964 Y:16680869-16680891 TAAGGCTACTTTGCTAGCCCAGG - Intergenic
1201926632 Y:19294715-19294737 TAAGGCTACTCTGCTTGCCCAGG + Intergenic