ID: 999119289

View in Genome Browser
Species Human (GRCh38)
Location 5:149196652-149196674
Sequence CCTGATTAGCAATCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999119289_999119292 -8 Left 999119289 5:149196652-149196674 CCTTCCTCTGATTGCTAATCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 999119292 5:149196667-149196689 TAATCAGGCCCCTTCCTCGCTGG No data
999119289_999119297 16 Left 999119289 5:149196652-149196674 CCTTCCTCTGATTGCTAATCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 999119297 5:149196691-149196713 GCATCCTTGCTTTAGCTGATTGG No data
999119289_999119299 28 Left 999119289 5:149196652-149196674 CCTTCCTCTGATTGCTAATCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 999119299 5:149196703-149196725 TAGCTGATTGGTACATTCAGTGG 0: 1
1: 0
2: 1
3: 3
4: 66
999119289_999119300 29 Left 999119289 5:149196652-149196674 CCTTCCTCTGATTGCTAATCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
Right 999119300 5:149196704-149196726 AGCTGATTGGTACATTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999119289 Original CRISPR CCTGATTAGCAATCAGAGGA AGG (reversed) Intronic
904418380 1:30376239-30376261 CCTGATTTGAGAGCAGAGGAGGG - Intergenic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
905861034 1:41351605-41351627 CCTGATTAGAACAAAGAGGAGGG + Intergenic
908948644 1:69531219-69531241 CCAGATTAGGAATCAGAGACAGG - Intergenic
910679673 1:89849598-89849620 CCTCACTAGCAATCAGAAAAAGG - Intronic
911157011 1:94646817-94646839 TCTGATTAGCGATCAGAGGAAGG - Intergenic
912546357 1:110454238-110454260 CTGGATCAGCTATCAGAGGAGGG - Intronic
915536679 1:156540623-156540645 ATTGATTAGCAAGCAGAGAATGG + Intronic
915930245 1:160056075-160056097 CCTAGTTACCAATCAGATGAGGG - Intronic
916787240 1:168095563-168095585 CCGGATCAGTCATCAGAGGAAGG + Intronic
917631797 1:176897918-176897940 CATGCTTAGTAATGAGAGGAGGG - Intronic
917666073 1:177227089-177227111 ACTGATTAGCAACCAGATCATGG + Intronic
918403700 1:184191224-184191246 CCTGATTGGCAAGAAGAGGCAGG - Intergenic
918432897 1:184480786-184480808 CATGAATGGCATTCAGAGGAGGG + Intronic
1065332896 10:24621369-24621391 CCTGTATAGAAATGAGAGGAAGG + Exonic
1074216664 10:111391684-111391706 ACTGTTTAGCAATTTGAGGAAGG - Intergenic
1074969403 10:118523410-118523432 TCTGATTGGTAATCAGAGGGTGG - Intergenic
1077396300 11:2324785-2324807 CTTTATTAGCAATGTGAGGATGG + Intergenic
1080845383 11:36022208-36022230 CATGATTAATAATTAGAGGAAGG - Intronic
1082563637 11:54649214-54649236 CCTGACAAGCAATCAGGGAAAGG - Intergenic
1084071655 11:66740468-66740490 CCTGATAAGAAAGCAGAGGGAGG + Intergenic
1087269318 11:96095433-96095455 GCTGATTGGTAATCAGAGAAAGG + Intronic
1087387952 11:97497081-97497103 CCTGATTAGAAATAGGAGGAAGG + Intergenic
1092632507 12:10397506-10397528 CTTGATTAGCGGTCAGAGGTTGG + Intronic
1094073553 12:26447285-26447307 TCTGATTAGAAATCAGATGATGG + Intronic
1098670529 12:73223913-73223935 CCTCATTAGAAATCAGAGAAAGG - Intergenic
1098943956 12:76569784-76569806 CCTTGTTATCAATGAGAGGATGG - Intergenic
1100686950 12:96996753-96996775 CCTGAATAGCAAACAAAGGAAGG + Intergenic
1100687022 12:96997556-96997578 CCTGACTGGCAAACAAAGGAAGG + Intergenic
1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG + Intronic
1111225432 13:85265392-85265414 CCTGATTAGCAAGATGAGGCAGG + Intergenic
1111225443 13:85265619-85265641 CCTGATTAGCAAGATGAGGCAGG - Intergenic
1113441426 13:110331739-110331761 ACTCATTAGGAATCAGAGAAAGG - Intronic
1117594812 14:57315669-57315691 CCTGATTAGCATTCTTCGGATGG - Intergenic
1120170024 14:81238748-81238770 CCTAAGGGGCAATCAGAGGAGGG + Intergenic
1124422389 15:29534151-29534173 CCTGATTAGGAAGGAGAGCAAGG - Intronic
1126539524 15:49806324-49806346 TCTGATTATCAAACCGAGGATGG - Intergenic
1126741462 15:51780596-51780618 CCAGAATAGAACTCAGAGGAGGG + Intronic
1127137626 15:55941079-55941101 CAATATTAGGAATCAGAGGAGGG - Intronic
1127331128 15:57941023-57941045 CCTTACTAGTAATCAGAGCAGGG - Intergenic
1127879586 15:63144890-63144912 TCTTATTGGCAATTAGAGGAAGG - Intronic
1128792109 15:70441090-70441112 CCTGGGTAGCAATCACAGGAGGG + Intergenic
1130893160 15:88150424-88150446 CCTTATTACAAGTCAGAGGAAGG + Intronic
1134279045 16:12802044-12802066 CCTGAGAAGAAATCAGAGCAGGG - Intronic
1136246337 16:28978322-28978344 TCTGATCAGGAATGAGAGGAGGG - Intronic
1137525866 16:49235766-49235788 CCTGCTTAGCTTTCAAAGGAAGG + Intergenic
1138095340 16:54206986-54207008 CCTGATTTCCAATCACAGGTCGG - Intergenic
1139635927 16:68258406-68258428 CCTGATCAGCACTTGGAGGATGG + Intronic
1140740762 16:77939130-77939152 TCTGTTTAGCTAGCAGAGGAAGG - Intronic
1140839784 16:78827918-78827940 CCTCATTAGGAGTCAGAGTAAGG + Intronic
1144304845 17:13959664-13959686 CCTGATTAAAAATCAAAGAAAGG - Intergenic
1144863336 17:18319337-18319359 CCTGAGAAGCACTCAGAGGGTGG + Intronic
1148168413 17:45500379-45500401 CCTGAATTGCCCTCAGAGGACGG - Intergenic
1150399605 17:64846830-64846852 CCTGAATTGCCCTCAGAGGAAGG - Intergenic
1152151103 17:78601856-78601878 CCTTACTAGGAATCAGAGAAAGG - Intergenic
1155079907 18:22398571-22398593 CCTGATTTGCAATCGGAGCCTGG + Intergenic
1155316058 18:24571251-24571273 CATCATTAGCCATCAGAGAAAGG - Intergenic
1157378085 18:47184400-47184422 CCTGATTAGAAATGGGAGCAGGG + Intergenic
1159393150 18:67821399-67821421 CCTGACTAGAAATGAGAGAAAGG - Intergenic
1160124744 18:76161220-76161242 CCTGATTTGGAGTCAGAGAAAGG - Intergenic
1160358833 18:78252447-78252469 CCTGATTAGAACCCAGAGGAAGG + Intergenic
1160478490 18:79216557-79216579 CTTGACTAGCAATCAGGGTAGGG - Intronic
1161672104 19:5618961-5618983 CCTCATTATAAATCAGAGTAAGG - Intronic
1168693875 19:58394342-58394364 CCTGATTTGCAATCAGATAGAGG - Intronic
925230141 2:2225799-2225821 CCACAATAGCAATCTGAGGAGGG + Intronic
928213423 2:29340952-29340974 CCTGACTAGCACTCAGGGGATGG + Intronic
933040733 2:77462749-77462771 CCTAATTAGCAATCAGCATAAGG + Intronic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
936427867 2:112435267-112435289 CATTATTAGCAAGGAGAGGAGGG - Intergenic
938104824 2:128522673-128522695 CCTCATTAGTGATCAGAGAAAGG - Intergenic
946095630 2:217271922-217271944 CCTCCTTAGGAATCTGAGGAAGG + Intergenic
947330532 2:229025113-229025135 GCTGATTTGCATACAGAGGAGGG + Exonic
1170014422 20:11764953-11764975 GCTAATGGGCAATCAGAGGAAGG + Intergenic
1170329593 20:15193868-15193890 CCAGATTAGTAATGAGATGATGG + Intronic
1172057035 20:32161254-32161276 CCTGAGGAGGAAACAGAGGAAGG - Exonic
1173775672 20:45704267-45704289 CCTGCTCAGAACTCAGAGGAAGG + Intronic
1176374382 21:6079944-6079966 CATTATTAGCAAGGAGAGGAGGG + Intergenic
1179749094 21:43458301-43458323 CATTATTAGCAAGGAGAGGAGGG - Intergenic
1181339543 22:22166766-22166788 CCAGATGGGCAATCAGAGCATGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
950162353 3:10769989-10770011 CCTCATTACCAATCAGGGAAAGG + Intergenic
950429764 3:12944048-12944070 CCTGATTCTCAATCTGATGAGGG - Intronic
951947327 3:28154882-28154904 CCAGATTAGAAATCAGAAAAAGG - Intergenic
959653570 3:108775443-108775465 CCTTTTAAGCAATCAGAAGAAGG - Intergenic
962120449 3:132555194-132555216 GGTGATTAGCCATCAGATGAAGG + Intergenic
963119610 3:141764946-141764968 CCTGGTGAGAAATCAGGGGAGGG - Intergenic
965004182 3:162996942-162996964 CCTGATTGGTAATCTGATGAAGG + Intergenic
968423259 4:503031-503053 CTTGACTAGTAATCAGAGCAGGG + Intronic
970455410 4:16218517-16218539 TGGGATTAGCAACCAGAGGAAGG + Intronic
971182505 4:24342829-24342851 CCTGATCAGCTAGCAGAGCAAGG - Intergenic
972662789 4:41132488-41132510 CCTGATTAGCAATCAGATTCTGG + Intronic
978052860 4:104224071-104224093 CATGTTTAGCAATCTTAGGATGG - Intergenic
978618303 4:110616562-110616584 CCTGTTTAGATGTCAGAGGATGG + Intergenic
980880069 4:138700936-138700958 CCTGACAGGAAATCAGAGGAAGG + Intergenic
981573603 4:146179150-146179172 CCTGAGTAGGAGTCAGGGGAGGG + Intronic
982632412 4:157847295-157847317 GCTGATTAGGAACCATAGGAAGG + Intergenic
983186195 4:164703768-164703790 CCTCATTAGTAATCAGAAAATGG + Intergenic
984599599 4:181710948-181710970 TCTAATTGGCAATCAGAGAAGGG + Intergenic
986602173 5:9483371-9483393 CATGATTAGCAAACAGAGACTGG - Intronic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
993095832 5:83476548-83476570 CCTGATTTGGAATCAGAAAAGGG + Intronic
996540785 5:124628794-124628816 CCTGCTAAGCATTCAGAGGGAGG + Intergenic
999119289 5:149196652-149196674 CCTGATTAGCAATCAGAGGAAGG - Intronic
1000370837 5:160535058-160535080 GCTGATTAGCATTAAGAGGATGG - Intergenic
1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG + Intergenic
1007050561 6:38824347-38824369 GCTGATTGGCACTCAGAGGCGGG + Intronic
1010165164 6:72906392-72906414 CCTGATCAGAACTCAGGGGAGGG - Intronic
1010806378 6:80241836-80241858 CCTCATTAGCAATTACAGAAAGG - Intronic
1014341695 6:120216231-120216253 CCTGATTAGAAATCATTTGATGG - Intergenic
1014865956 6:126530525-126530547 CTTGTTTAGCAATATGAGGAGGG + Intergenic
1015998743 6:139021246-139021268 CCTCATTAGTGATCAGAGAAAGG - Intergenic
1016410008 6:143772924-143772946 CCTCATTAGCATTAAGAGGCTGG + Intronic
1018222848 6:161598521-161598543 CCTTCTTAGCAATGAGAGGCTGG + Intronic
1020895277 7:13931529-13931551 CCTGTTTAATCATCAGAGGAGGG + Exonic
1022543540 7:31162608-31162630 CCTCATTAGGAATCAGAGCAGGG - Intergenic
1023125895 7:36954041-36954063 CCTGCCTAGGAATCAGAGCAAGG - Intronic
1028318398 7:89433024-89433046 CATCATTAGCAATCAGAGAAAGG - Intergenic
1028674175 7:93439773-93439795 CCTTGTTAGAAATCAAAGGAAGG - Intronic
1035613170 8:982419-982441 GCTGTTTAGCAATCAGTCGATGG + Intergenic
1035917850 8:3644494-3644516 TCTGATTAGCAAAAAGAAGATGG + Intronic
1045210803 8:100097723-100097745 CCAGAGTAGTAATCAGAAGATGG - Intronic
1045333932 8:101181344-101181366 ACTGATTTTCAATCAGAGAAGGG - Intronic
1045393000 8:101733757-101733779 CCTGGCTAGCAATCTGAGGAGGG - Intronic
1048586242 8:135776837-135776859 CCTGATCAGGTATCAGACGAGGG + Intergenic
1048934907 8:139346734-139346756 CCTAATTAGCAAGGAGAGAAGGG + Intergenic
1051755985 9:20401340-20401362 CCTAATTAGAAAACACAGGAAGG + Intronic
1054943678 9:70771740-70771762 CTTGATTAGCACTGAGGGGAGGG - Intronic
1055424753 9:76182615-76182637 CATCATTAGCAAACAGACGAAGG + Intronic
1057739076 9:97696526-97696548 CCTACTCAGCAATCAGAAGAAGG - Intronic
1058552453 9:106129349-106129371 AGTGATGAGAAATCAGAGGAGGG - Intergenic
1058779550 9:108319159-108319181 CCTTATTAGCAGTGTGAGGATGG + Intergenic
1187823853 X:23315358-23315380 CATGACTAGCAAGGAGAGGAAGG - Intergenic
1190183470 X:48214511-48214533 CCTGAGAAGCCAGCAGAGGAAGG + Intronic
1190503593 X:51103188-51103210 CCTGATTCTCAGTCAGAGGCTGG + Intergenic
1190895539 X:54614413-54614435 CCTGATCAGAACTCAGGGGAGGG - Intergenic
1193325985 X:80179057-80179079 CCTGTGTAGAAATCATAGGATGG + Intergenic
1194982041 X:100450655-100450677 CCTGTTTAGCTATGAGAGGTGGG - Intergenic
1198307386 X:135396541-135396563 CCTGTTTGGTAATCAGGGGAGGG + Intergenic
1198571949 X:137966796-137966818 CCAGATGAGAAATCAGAAGAGGG + Intergenic
1198994187 X:142555030-142555052 CCTCATTAGCAATGAAAGGTTGG + Intergenic