ID: 999119583

View in Genome Browser
Species Human (GRCh38)
Location 5:149198761-149198783
Sequence CCTCATCCACAGGTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999119572_999119583 -8 Left 999119572 5:149198746-149198768 CCCATCCTCCCACACCCTCATCC 0: 1
1: 0
2: 7
3: 124
4: 1086
Right 999119583 5:149198761-149198783 CCTCATCCACAGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 22
4: 274
999119573_999119583 -9 Left 999119573 5:149198747-149198769 CCATCCTCCCACACCCTCATCCA 0: 1
1: 1
2: 18
3: 222
4: 1940
Right 999119583 5:149198761-149198783 CCTCATCCACAGGTGGGACAGGG 0: 1
1: 0
2: 3
3: 22
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999119583 Original CRISPR CCTCATCCACAGGTGGGACA GGG Intronic
900031068 1:373604-373626 ACACAGCCACATGTGGGACAGGG + Intergenic
900051639 1:601858-601880 ACACAGCCACATGTGGGACAGGG + Intergenic
900377362 1:2361716-2361738 CCTCATCCCCACGTTGGCCAAGG - Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901971494 1:12912342-12912364 CCACATCCACAGGACGGAGAGGG + Intronic
903354311 1:22736865-22736887 CCTCCTCCCCAGGTCTGACAGGG - Intronic
904052563 1:27648568-27648590 CCTCATCCTCAGGTGGGCCAGGG + Intergenic
904459348 1:30666414-30666436 CATCCTCCACAGGTGGGCCCTGG - Intergenic
905167667 1:36092410-36092432 CCTAAACCACAGGTTGGGCATGG + Exonic
907536757 1:55168567-55168589 CATCAACCCCAGGTGGGACAGGG + Intronic
907958612 1:59256117-59256139 CCCCATCAACAAGTGGGAGAAGG + Intergenic
908102808 1:60808718-60808740 CTAAATCCACAGGTGGGGCAAGG + Intergenic
908322485 1:62991740-62991762 CATCAGCCACAGGTGGGAGGTGG - Intergenic
908486135 1:64595596-64595618 CCTCATCACCAGGTTGGACTGGG - Intronic
909297339 1:73967586-73967608 CCTCATCCAAAAGTGGGCAAAGG + Intergenic
911147049 1:94562510-94562532 CGTCACCCCCAGGTGGGACTGGG - Intergenic
911795091 1:102065581-102065603 CCCCATCCACAAGTGGGTGAAGG + Intergenic
911884998 1:103287092-103287114 CCTCATCAACAAGTGGGCGAAGG - Intergenic
915018090 1:152755426-152755448 CCACATGCACAGCTGGGTCATGG + Intronic
917384798 1:174460414-174460436 CCTAATCCATAGGGGGGAAATGG - Intronic
918362192 1:183770940-183770962 CCTCATCCACAGGGGAGGGAGGG - Intronic
918646623 1:186913860-186913882 CTGCAACCACATGTGGGACAGGG - Intronic
918813340 1:189149865-189149887 GGCCATCCACAGGTGGGACGAGG + Intergenic
918946956 1:191078577-191078599 CCCCATCCACAAGTGGGCGAAGG - Intergenic
919052801 1:192532260-192532282 CCCCATCAACAAGTGGGAGAAGG - Intergenic
919466102 1:197922688-197922710 TCTCAGCCACATGTGGGCCAGGG - Intronic
919920339 1:202163412-202163434 CCACAGCCTCAGATGGGACAAGG - Intergenic
919944018 1:202306948-202306970 CCACATCCAGGGGTGGGCCATGG + Intronic
920049470 1:203154620-203154642 CCTAGTACACAGCTGGGACAGGG + Intronic
920837789 1:209528033-209528055 CCTCAGCCCCAGGTGGGAAAAGG + Intergenic
922325263 1:224522473-224522495 CCCAAGCCACAGGTGGGAGAAGG + Intronic
922559522 1:226559013-226559035 CCTAATCAAAAGGTAGGACACGG + Intronic
924044421 1:240012484-240012506 CATCATCCCCACATGGGACAGGG + Intergenic
924209893 1:241753876-241753898 CCACATCCACAGATGGGATATGG + Intronic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1064841962 10:19603018-19603040 CCCCATCAACAGGTGGGCAAAGG - Intronic
1066517956 10:36184920-36184942 CCTCATCCTCAGGAGACACATGG + Intergenic
1067037276 10:42930010-42930032 CCTCCTCCCCTGGTAGGACAAGG + Intergenic
1070930871 10:80259762-80259784 TCTCTGCCACAGGCGGGACATGG + Intergenic
1071218978 10:83441356-83441378 CCTCATCAACAAGTGGGCAAAGG + Intergenic
1072306810 10:94115589-94115611 CCTCATCAACAAGTGGGCGAAGG - Intronic
1074404090 10:113165737-113165759 CATCATGGACAGGTGGGCCAGGG - Exonic
1074584256 10:114751795-114751817 ACTCATGCACAGGGGGGAAATGG + Intergenic
1076619976 10:131780836-131780858 CCTCATCCCCTGGTTGGACAGGG - Intergenic
1076674090 10:132138886-132138908 CCTCATCCACAGGCCCCACAGGG + Intronic
1076807434 10:132866103-132866125 CAGCATCCACAGGTGGGGAAAGG + Exonic
1077506618 11:2932531-2932553 GCTCAGCCCCAGGTGGGACCAGG - Intergenic
1078296682 11:10077956-10077978 CCTCATCAACAAGTGGGCAAAGG + Intronic
1078977555 11:16495560-16495582 CTTGAACCACAGGTGGCACATGG - Intronic
1079305714 11:19319582-19319604 CTTCATCCCCAGGTTGCACAAGG + Intergenic
1081326978 11:41756879-41756901 CCTCATCAACAAGTGGGCAAAGG - Intergenic
1081860601 11:46331511-46331533 CCTCTTCCATAGGCAGGACAGGG + Intergenic
1081993683 11:47350694-47350716 CCTCATCCACAGCGGGCTCATGG - Intronic
1084550857 11:69840883-69840905 CCCCAGCCACGGGTGGGACAGGG + Intergenic
1085392193 11:76188169-76188191 CCTGACCCACAGGAGGCACATGG - Intronic
1085684063 11:78605763-78605785 CACCATCAACAGGTGGGATAAGG + Intergenic
1086565264 11:88219017-88219039 CCTCATCAACAAGTGGGCAAAGG - Intergenic
1086790891 11:91036918-91036940 CCTCATCAACAAGTGGGCAAAGG + Intergenic
1087398491 11:97633790-97633812 CCCCATCTACAAGTGGGAGAAGG - Intergenic
1089524170 11:119085766-119085788 CCTCACCAACAGGCTGGACAGGG - Intronic
1089631145 11:119785196-119785218 CCTAATCCAAAAGTGGGAGATGG - Intergenic
1090998527 11:131888732-131888754 GCTCATCCACAGGGGGTAAAGGG + Intronic
1091299837 11:134500618-134500640 CCACATCCACAGGTGGAAAGAGG - Intergenic
1091915394 12:4269401-4269423 CGTCATCCACACGTGGGGGAAGG - Intergenic
1092525111 12:9305093-9305115 CTTCTCCCACAGCTGGGACATGG + Intergenic
1092542155 12:9426725-9426747 CTTCTCCCACAGCTGGGACATGG - Intergenic
1093313750 12:17623385-17623407 CCCCATCCACAAGTGGGCGAAGG - Intergenic
1093465689 12:19446437-19446459 TCCCATCTACAGGCGGGACACGG + Intronic
1094510857 12:31095708-31095730 CTTCTCCCACAGCTGGGACATGG + Intronic
1095818894 12:46455320-46455342 CTTCATCCACTGATGGGAGATGG + Intergenic
1097231285 12:57512953-57512975 CTTCATCAACAGGTAGGACTTGG + Exonic
1101358650 12:104005551-104005573 CCCCATCAACAAGTGGGAGAAGG + Intronic
1101817807 12:108159118-108159140 CAACCTCCAGAGGTGGGACAGGG - Intronic
1101991626 12:109490159-109490181 CCTGACCCACAAGTGAGACAAGG - Intronic
1102560261 12:113756981-113757003 CCTCTTCCCCAGGTCGGGCAGGG + Intergenic
1103593173 12:122006608-122006630 CCTCACCTGCAGGTGGGACCGGG - Intergenic
1103875396 12:124123278-124123300 CCACCCCCACAGATGGGACAAGG + Intronic
1103894705 12:124265220-124265242 TTTCCTCCAAAGGTGGGACAGGG + Intronic
1104091816 12:125523954-125523976 CCTCATCCCCAGGGGGGATGTGG + Intronic
1104809180 12:131610359-131610381 CCTCATAGACAGGTGGGATCTGG - Intergenic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1109826553 13:67728843-67728865 CTTCCTCTGCAGGTGGGACATGG - Intergenic
1110054144 13:70943106-70943128 CCTCAGTCACAGGCTGGACATGG - Intergenic
1111234342 13:85389353-85389375 CCCCATCAACAAGTGGGAGAAGG + Intergenic
1113554138 13:111217780-111217802 CCTCTTCCACACGGGTGACATGG - Exonic
1114922986 14:27358364-27358386 CCCCATCCACAAGTGGGCAAAGG - Intergenic
1115357661 14:32465895-32465917 CCTCATCAAAATGTGGGAGAAGG + Intronic
1116618142 14:47164420-47164442 CCCCATCAACAGGTGGGCAAAGG + Intronic
1116675993 14:47906360-47906382 CCCCATCAACAAGTGGGAGAAGG + Intergenic
1118643479 14:67815833-67815855 CCTCAGCTACAGGAGGGACAAGG - Exonic
1118658204 14:67976884-67976906 CCTCATCAACAAGTGGGCGAAGG + Intronic
1120179618 14:81329988-81330010 CTTCCTCCACAGGAGGGAAAGGG + Intronic
1120607304 14:86595063-86595085 CCTCATCAACAAGTGGGCGAAGG + Intergenic
1122272389 14:100574037-100574059 GCTGACCCACAGGTAGGACAAGG + Intronic
1122426060 14:101606227-101606249 GCTCATCCACAGATGGGACATGG + Intergenic
1122548866 14:102539360-102539382 CCTCATCCATTGGTGGGATGCGG + Intergenic
1122825256 14:104367572-104367594 CCTCCTTCAATGGTGGGACAGGG + Intergenic
1124382353 15:29177292-29177314 CCTCATCCACGGGAAGGACAGGG + Intronic
1129421407 15:75430249-75430271 CTTCATACACAGGAGGGGCAGGG + Exonic
1129569246 15:76661497-76661519 CCTCATCAAAAAGTGGGCCAAGG + Intronic
1129915558 15:79266901-79266923 CCACACCCAGAGGTGGTACAGGG - Intergenic
1130761070 15:86820498-86820520 CCCCATCCAAAAGTGGGAGAAGG + Intronic
1131228683 15:90645456-90645478 CCTGACCCACAGCTGGTACAGGG - Intergenic
1131284644 15:91047190-91047212 CCTCATCAACAAGTGGGCGAAGG + Intergenic
1131447771 15:92513846-92513868 GGTCCTGCACAGGTGGGACACGG - Intergenic
1131993992 15:98116897-98116919 CCCCATCCACAAGTGGGTGAAGG + Intergenic
1132678560 16:1130629-1130651 ACACATCCACAGGTGGGCCCAGG - Intergenic
1134039114 16:11054219-11054241 CCTGATCCACAGGCGAGAGATGG + Intronic
1134320623 16:13159345-13159367 CCTCTTCCACAGCTAGGAAAAGG - Intronic
1136142733 16:28297890-28297912 CCTCACCCACACCTGGGGCAGGG - Intronic
1138000902 16:53278677-53278699 CCCCATCAACAAGTGGGAGAAGG + Intronic
1141218178 16:82044436-82044458 CCTCACCCACAGATGGGGCCTGG + Intronic
1143119346 17:4597378-4597400 CTTCTTCCCCAGGTGGGGCATGG + Intronic
1143306014 17:5947240-5947262 TCTCATCCACTGGAGGGACAGGG - Intronic
1145986917 17:29053205-29053227 CCTCATCCAGAGGGGGGTCTTGG - Intronic
1145992301 17:29086427-29086449 CCTCATCAACAGGTGAGAAGTGG - Exonic
1147690811 17:42313235-42313257 CCTCACACACAGGTGGGGCCTGG - Intergenic
1148046464 17:44747959-44747981 CCACAGCCCCAGGTGGGAGAGGG - Intronic
1149342440 17:55700564-55700586 CCCCATCCACAGGTGGAAATGGG + Intergenic
1151958638 17:77393262-77393284 ACCCAACCCCAGGTGGGACAAGG - Intronic
1152500818 17:80707858-80707880 CTTCATCCACAGTTGGGTCAAGG - Exonic
1152948572 17:83212065-83212087 ACACAGCCACATGTGGGACAGGG - Intergenic
1153418297 18:4875113-4875135 CCTCATCTACAGGGGGCTCAGGG + Intergenic
1154216511 18:12420319-12420341 CCGCAGCCACCCGTGGGACACGG + Exonic
1156293490 18:35770361-35770383 CTTCCTCCACAGGTAGGCCAGGG + Intergenic
1158324519 18:56299684-56299706 CCCCATCCAAGGGAGGGACAGGG + Intergenic
1159802739 18:72920989-72921011 CCTCATCAAAAAGTGGGCCAAGG + Intergenic
1160734952 19:658221-658243 CCTCATCCCCGGGTGGGACCTGG + Intronic
1161096898 19:2397267-2397289 CCTCATGCACAGCTGGGGGAAGG + Intronic
1161358084 19:3830586-3830608 CCCCATCCCCAGCTGGGTCAGGG + Intronic
1165682633 19:37790640-37790662 CTTCTTCCTCAGGTGGGACCAGG - Intronic
1166706735 19:44912251-44912273 TCAGATCCAGAGGTGGGACAAGG + Intergenic
1167073916 19:47237353-47237375 CATCACCCACAGGTGGCAGAGGG - Intergenic
927506911 2:23620749-23620771 CCCCATCCAGAGGTGGGAGAGGG + Intronic
928882095 2:36108264-36108286 CCCCATCAACAAGTGGGAGAAGG + Intergenic
929539399 2:42808762-42808784 CCTCATCCACAAGTGCTCCAAGG + Intergenic
932054894 2:68433552-68433574 CCTCATCCACTGCTGCTACAGGG - Intergenic
933686765 2:85147648-85147670 CTTCATCCACAAGTGGCACAGGG - Intronic
933841832 2:86293031-86293053 CCTCTTACACAGGAGGGACCTGG + Intronic
933853522 2:86391731-86391753 CCTCATCAAAAGGTGGGCGAAGG - Intergenic
935060415 2:99602190-99602212 ACTCAACTACAGGTGGGAAAAGG - Intronic
935847671 2:107184387-107184409 CCTCATCTACAGCTGAGAAAAGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937379581 2:121364418-121364440 CCAGCTCCACAGGTGGGAGAAGG + Intronic
937744160 2:125390745-125390767 CCCCATCAACAAGTGGGAGAAGG - Intergenic
939077803 2:137624643-137624665 CCTCATCAACAAGTGGGTGAAGG + Intronic
941237020 2:162987587-162987609 CCCCATCAACAAGTGGGCCAAGG + Intergenic
943081451 2:183262839-183262861 CCTCATCAACAAGTGGGCGAAGG + Intergenic
943139993 2:183970425-183970447 CCTCATCCAAAAGTGGGTGAAGG - Intergenic
943545508 2:189271828-189271850 CCTCATCAAAAAGTGGGCCAAGG + Intergenic
946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG + Intergenic
946661263 2:222002568-222002590 CCACATCAACAAGTGGGAGAAGG + Intergenic
947268332 2:228306150-228306172 TCTCCACCACAGGTTGGACAGGG + Intergenic
948532179 2:238616069-238616091 ACTCATCCACAGCTGTGACAAGG - Intergenic
948587017 2:239026032-239026054 CCTCCCCCACAGCTGGGACGTGG + Intergenic
1169196645 20:3686640-3686662 CTAAATCCAGAGGTGGGACAGGG - Intergenic
1170246977 20:14231962-14231984 CCCCATCAACAAGTGGGAGAAGG - Intronic
1171076729 20:22134495-22134517 CCCCATCAACATGTGGGAGAAGG + Intergenic
1171441953 20:25171580-25171602 CCTCATCAAAAAGTGGGAAAAGG + Intergenic
1173228266 20:41174695-41174717 CTTCATCCAGAGCTGGGGCATGG - Exonic
1173467813 20:43297415-43297437 CCTCATTCACAGTTTGGAGATGG - Intergenic
1173793349 20:45841946-45841968 CCTCACCCACAGGTGGCTCTCGG - Exonic
1175221054 20:57416660-57416682 CCTCATCCTCAGGGTGGGCAGGG + Intergenic
1175703077 20:61154631-61154653 TCTCAGCCACAGGTGTGCCAAGG - Intergenic
1176212520 20:63931954-63931976 CCTCAAGCACAGGTAGGAAAGGG - Exonic
1177294073 21:19152383-19152405 CCCCATCAACAGGTGGGCGAAGG + Intergenic
1177877784 21:26655150-26655172 CCCCATCAACAGGTGGGTGAAGG + Intergenic
1178510846 21:33203589-33203611 CCTCGTCACCAGCTGGGACAAGG + Intergenic
1178611469 21:34085716-34085738 CCTCAGCCCCAGCTGGGACTGGG + Intronic
1184832501 22:46997759-46997781 CCTCAGCCCTCGGTGGGACAGGG + Intronic
949162559 3:897532-897554 CCTCATCCAAAAGTGGGCCAAGG - Intergenic
950720043 3:14876102-14876124 CCTCTCCCACAGGTAGGACATGG + Intronic
951413615 3:22396089-22396111 CCCCATCAACAGGTGGGTGAAGG - Intergenic
952012797 3:28920181-28920203 CCTAATTCAGACGTGGGACAGGG + Intergenic
953041683 3:39261161-39261183 CTTCATCCACAGGAGGGCCAAGG - Intergenic
953500363 3:43427188-43427210 ACTTGTCCACAGGTGGCACAAGG + Intronic
953522152 3:43653976-43653998 CCTCATATCCAGGTGTGACAAGG - Intronic
954515258 3:51169573-51169595 CCTCATCCTCAGGTGGGCCCCGG - Intronic
956034977 3:65080810-65080832 CAAAATCCACTGGTGGGACAAGG - Intergenic
956199622 3:66692803-66692825 CCTCATCCACATGTGAAAAAGGG - Intergenic
957116502 3:76033763-76033785 CCTCATTCACACGTGTGGCATGG + Intronic
957155096 3:76536025-76536047 GGTCCTGCACAGGTGGGACATGG + Intronic
957481725 3:80806578-80806600 GCTCATGCACAGGTGATACATGG + Intergenic
958660066 3:97055370-97055392 CCTCATCCATAGGGGGAACTTGG + Intronic
959642836 3:108660803-108660825 CCCCATCAACAGGTGGGCAAAGG + Intronic
961698559 3:128724003-128724025 CCTCATCCCCAGGTTTGGCAGGG - Intergenic
962702205 3:138010517-138010539 CCTCACCCAGAGGTGGGAGTGGG - Intronic
962962490 3:140323347-140323369 CCTCTTCCACAGGTTATACAAGG + Intronic
963018523 3:140849173-140849195 CCTCATGCCCAGGTAGGATATGG + Intergenic
967820967 3:193838464-193838486 CCCCATCAAAAGGTGGGCCAAGG + Intergenic
968943002 4:3648869-3648891 CCTCATCCTCAGGTGAGAAAGGG + Intergenic
969254952 4:5995250-5995272 CCTCCTCCCTGGGTGGGACATGG - Intergenic
969671418 4:8592348-8592370 CCGCATCCACACAGGGGACAAGG + Intronic
971946852 4:33289624-33289646 CCCCATCAACAAGTGGGAAAAGG + Intergenic
972686588 4:41359283-41359305 CCTCACCCGCAGGCGGGACCTGG + Intergenic
973064618 4:45773306-45773328 CCTCATCAACAAGTGGGTGAAGG - Intergenic
977421159 4:96801640-96801662 CATCATCGACAGGTAGGCCAGGG + Intergenic
979418878 4:120478655-120478677 CCTCATCAACAAGTGGGCAAAGG + Intergenic
979965335 4:127069999-127070021 CCTCACTCACATGTGGGACCAGG - Intergenic
980395411 4:132207672-132207694 CCTCATCAACAAGTGGGCAAAGG - Intergenic
980588364 4:134850103-134850125 CCCCATCCACAAGTGGGCGAAGG + Intergenic
980769791 4:137356202-137356224 CCTCATCCAAAAGTGGGTGAAGG + Intergenic
981188978 4:141838942-141838964 CCCCATCCACAAGTGGGCGAAGG + Intergenic
981284207 4:142996203-142996225 CCCCATCCACAAGTGGGCGAAGG + Intergenic
981338064 4:143589066-143589088 CCCCATCCACAAGTGGGCCAAGG - Intronic
981859360 4:149336407-149336429 CCTCATCAAAAAGTGGGAGAAGG - Intergenic
981869877 4:149473293-149473315 CCTCATCAAAAAGTGGGAGAAGG + Intergenic
982056281 4:151551995-151552017 CCCCATCAAAAGGTGGGAGAAGG + Intronic
983685021 4:170397958-170397980 CCTCATTTACAGTTGTGACAAGG + Intergenic
983867804 4:172789330-172789352 CCTGAGCCACATGTGAGACACGG - Intronic
986308790 5:6535958-6535980 CCTCAACCACAGCCAGGACAGGG - Intergenic
986456908 5:7928646-7928668 CTTCATCCACAGCTGTGAGAGGG - Intergenic
989831270 5:45922584-45922606 CCCCATCCACAAGTGGGCGAAGG - Intergenic
990189551 5:53243638-53243660 CCTCGCCCACAGGTGAGCCATGG - Intergenic
990226458 5:53660822-53660844 CCTCATCAACAAGTGGGCGAAGG - Intronic
990435437 5:55785751-55785773 CCTCATCCTCAGGTGGAGGAGGG - Exonic
991282749 5:64934925-64934947 CCTCATCAAAAAGTGGGAAAAGG - Intronic
991985608 5:72283454-72283476 CCTCATCCACAGCTGGAGCTTGG + Intronic
992034829 5:72762724-72762746 CCTCATCCAAAGGCTGGAGAAGG + Intergenic
994170416 5:96653475-96653497 CTTCATCCACAGCTGGGAGGTGG - Intronic
994835455 5:104846304-104846326 CCTAATCCAAAGGTGTGATAGGG - Intergenic
995117302 5:108495725-108495747 CCCCATCAACAGGTGGGCGAAGG + Intergenic
996438135 5:123458676-123458698 CCCCATCAACAAGTGGGAGAAGG + Intergenic
996540931 5:124629622-124629644 GCTCATCCAGAGGTGGGAGGGGG + Intergenic
997597811 5:135118845-135118867 CCACCTCCACAGCTGAGACACGG - Intronic
997621765 5:135303732-135303754 CCTCAGCCACAGGTAAAACATGG - Intronic
997978508 5:138454340-138454362 TCTGACCCACAGGTGGGAGAAGG + Intergenic
998926837 5:147135852-147135874 CCCCATCCCCTGATGGGACACGG + Intergenic
999119583 5:149198761-149198783 CCTCATCCACAGGTGGGACAGGG + Intronic
999671740 5:153964592-153964614 CCTCATCCACAGCTGGGCAAGGG + Intergenic
999802167 5:155048438-155048460 CCTCATCCACGGGAGAGACAGGG - Intergenic
1001254162 5:170170977-170170999 GCTGATCCAGAGGTGAGACACGG - Intergenic
1002400675 5:178990196-178990218 CCAGATCCACAGGTAGGACTGGG + Intronic
1002742752 5:181445264-181445286 ACACAGCCACATGTGGGACAGGG - Intergenic
1002796023 6:471545-471567 AAACATCCCCAGGTGGGACAGGG - Intergenic
1003447042 6:6194231-6194253 CCTCACTTACAGGAGGGACAAGG + Intronic
1004701869 6:18087158-18087180 CCACTCCCACAGGTGGGAAAAGG + Intergenic
1005662634 6:28014666-28014688 GCTGATCCAGAGGTGGGAAAAGG + Intergenic
1006360647 6:33585319-33585341 CCACTTCCACAGTTTGGACAAGG + Intergenic
1006474785 6:34246858-34246880 CCTCCCCGACAGGTGGTACATGG - Exonic
1007662179 6:43493570-43493592 CCTCAGCCTCAGCTGGGAGAAGG + Intronic
1008059814 6:46985215-46985237 ACTTCTCCACAGGTGGGAGAAGG - Intergenic
1008073966 6:47126755-47126777 CCCCACTCTCAGGTGGGACAGGG + Intergenic
1008817569 6:55587216-55587238 CCCCATCAACAAGTGGGAGAAGG - Intergenic
1009268616 6:61589670-61589692 AATCATCCACTGGTGGGACTGGG - Intergenic
1009462774 6:63934068-63934090 CCCCATCAACAGGTGGGTGAAGG + Intronic
1012251729 6:96988272-96988294 CCCCATCCACAAGTGGGTGAAGG + Intronic
1012916058 6:105172202-105172224 CCTCATCAACAAGTGGGCGAAGG + Intronic
1017073822 6:150600098-150600120 CCACATCCGCAGGTGGGGCCGGG + Intronic
1018046666 6:159971287-159971309 CTTCATCTCCAGGTGGAACACGG + Intronic
1018507366 6:164485760-164485782 CCCCATCAAAAGGTGGGAGAAGG - Intergenic
1019247885 6:170721003-170721025 ACACAGCCACATGTGGGACAGGG - Intergenic
1019288791 7:236935-236957 CCTCTTCCAGGAGTGGGACATGG + Intronic
1019519784 7:1455409-1455431 CCACAGCCGCAGGTGAGACAGGG + Intronic
1019519942 7:1456049-1456071 CCTCATCCAGAGGTACGGCAGGG + Intronic
1021429014 7:20538307-20538329 CCCCATCAACAAGTGGGCCAAGG + Intergenic
1024407952 7:49004429-49004451 CCTCATCAACAAGTGGGCGAGGG - Intergenic
1025997467 7:66537102-66537124 CCTCAGCCTCGGGTGGGGCAGGG - Intergenic
1026731422 7:72914921-72914943 TCTCACCAACAGGTGGGTCAGGG - Intronic
1026742984 7:72990472-72990494 GTTCATTCCCAGGTGGGACAGGG - Intergenic
1026990343 7:74581577-74581599 CCTCGGCCTCAGGTGGGGCAGGG - Intronic
1027029099 7:74875176-74875198 GTTCATTCCCAGGTGGGACAGGG - Intergenic
1027100751 7:75374606-75374628 GTTCATTCCCAGGTGGGACAGGG + Intergenic
1027112618 7:75452902-75452924 TCTCACCAACAGGTGGGTCAGGG + Intronic
1030473903 7:110003563-110003585 CTTCATCCTCAGGTAGGCCATGG - Intergenic
1033496206 7:141899084-141899106 CCCCATCAACAAGTGGGAGAAGG + Intergenic
1035024929 7:155819016-155819038 GTTCATCCAGAGGTGGGAGAAGG + Intergenic
1035500230 8:86861-86883 ACACAGCCACATGTGGGACAGGG + Intergenic
1035689918 8:1553308-1553330 CCTCTTCCCCAGGAGGGCCAGGG - Intronic
1036153879 8:6324195-6324217 TCTCATCAACAGGTGGGATTGGG + Intergenic
1037386401 8:18347379-18347401 CCTCAACCACAGGCAGGGCAAGG + Intergenic
1037804719 8:22052829-22052851 ACTCATCCACATGTGCTACATGG - Intronic
1038356366 8:26832751-26832773 CCTCCCCCACAGGTGTGACAAGG - Intronic
1038782543 8:30580536-30580558 GAACATCCACATGTGGGACACGG + Intronic
1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG + Intergenic
1045856364 8:106769791-106769813 CCTCAGCCACAGGTACGAGAGGG - Exonic
1047496378 8:125412030-125412052 CCTCCTCCACACAGGGGACAGGG - Intergenic
1048014530 8:130485636-130485658 CCTCCTCCACAGGTGGGATATGG - Intergenic
1049266789 8:141671864-141671886 CATCATCCTCATGGGGGACAGGG - Intergenic
1049288471 8:141789252-141789274 GCTCATGCACAGGTGGGGCCTGG + Intergenic
1049709480 8:144057197-144057219 GCACATCCACAGGTGGGCCTGGG - Exonic
1053924253 9:43035929-43035951 ACTCATACATACGTGGGACAGGG + Intergenic
1056381908 9:86063382-86063404 CCTCTTCCGCAGGTGGGAGCAGG - Intronic
1057759003 9:97857869-97857891 CCTCATCCACAGCGGGGTCGCGG + Intergenic
1058988337 9:110230242-110230264 CCCCATCAACAAGTGGGAGAAGG - Intergenic
1059002145 9:110359637-110359659 CCCCATCAACAAGTGGGAGAAGG - Intergenic
1060037918 9:120274076-120274098 CCCCATCAACAAGTGGGCCAAGG + Intergenic
1060869379 9:127027608-127027630 CCTCATCCACTGGTGGGTGGGGG - Intronic
1061866812 9:133496466-133496488 CCTCACCCACAGACGGAACATGG - Intergenic
1203608655 Un_KI270748v1:76482-76504 ACACAGCCACATGTGGGACAGGG - Intergenic
1188552673 X:31379838-31379860 GGTCCTCCACAGATGGGACATGG - Intronic
1189693621 X:43641501-43641523 CATCTTCCACAGCTGAGACATGG - Intergenic
1190258757 X:48785150-48785172 ACACATGCACACGTGGGACAAGG - Intergenic
1190960648 X:55243439-55243461 CCTCATCAACAAGTGGGCGAAGG + Intronic
1194490078 X:94534968-94534990 CCTCATCAAAAGGTGGGCAAAGG + Intergenic
1196282682 X:113841218-113841240 CCTAATCCACAGGTGCAATATGG - Intergenic
1196990841 X:121327012-121327034 CCTAATCCACAGGATGGACTGGG - Intergenic
1198820092 X:140638243-140638265 CCTCATCAAAAAGTGGGCCAAGG + Intergenic
1201932320 Y:19364615-19364637 CCTCATCAAAAAGTGGGAAAAGG + Intergenic
1202058898 Y:20865460-20865482 CCCCATCAAAAGGTGGGAGAAGG - Intergenic