ID: 999121458

View in Genome Browser
Species Human (GRCh38)
Location 5:149212707-149212729
Sequence CCAGTTCTGCCAATGACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999121458_999121466 15 Left 999121458 5:149212707-149212729 CCTGGTGTCATTGGCAGAACTGG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 999121466 5:149212745-149212767 AAGCTGATCTGGCAGAAACATGG No data
999121458_999121465 4 Left 999121458 5:149212707-149212729 CCTGGTGTCATTGGCAGAACTGG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 999121465 5:149212734-149212756 GACAGGGGAAAAAGCTGATCTGG 0: 1
1: 0
2: 1
3: 23
4: 161
999121458_999121467 30 Left 999121458 5:149212707-149212729 CCTGGTGTCATTGGCAGAACTGG 0: 1
1: 0
2: 0
3: 8
4: 143
Right 999121467 5:149212760-149212782 AAACATGGCGAGTACCATTTAGG 0: 1
1: 0
2: 0
3: 5
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999121458 Original CRISPR CCAGTTCTGCCAATGACACC AGG (reversed) Intronic
900846022 1:5101726-5101748 CCAGCTCTGTCCATGACACATGG - Intergenic
902623861 1:17665586-17665608 TCAGTTCTGCCACTTACATCTGG + Intronic
903425801 1:23253272-23253294 CCAGTTCTGCCCATGCCCCAAGG - Intergenic
905862336 1:41360012-41360034 CCAGTCCTGGCCATGCCACCAGG + Intergenic
910127387 1:83858917-83858939 CCAGTTCTGTCTATGCCCCCAGG + Intergenic
913315291 1:117545337-117545359 TCAGCTCTGCCACTGACACTGGG - Intergenic
917835860 1:178941267-178941289 CCAGTTCTGAAAATAGCACCAGG + Intergenic
920607892 1:207407887-207407909 TCATATCTGCCAATGACAGCTGG - Intergenic
920831392 1:209469023-209469045 CCAGAGATGCCAATAACACCAGG + Intergenic
921723958 1:218504234-218504256 CCAGTCCTTCCTATGACACATGG + Intergenic
1064553863 10:16528883-16528905 CCAGTTATGAAAATGAAACCTGG - Intergenic
1065281543 10:24143842-24143864 CCAGTTCTGACCAGGACAGCAGG + Intronic
1065323068 10:24526640-24526662 CCAGCTCTGCCACTGACAAATGG + Intronic
1067796557 10:49325850-49325872 CCAGTCCTGCCAGGGTCACCCGG + Exonic
1068654428 10:59560085-59560107 CCAGTTCTTCCACTGTCACCTGG + Intergenic
1069696586 10:70390816-70390838 CCAGTTCTGCCATTGCACCCAGG + Intergenic
1070531570 10:77341833-77341855 CAAGTTCTGCCAAGGAATCCTGG - Intronic
1072211080 10:93247633-93247655 CCAGTACTGCCAATGCCAGGAGG + Intergenic
1072969201 10:100001920-100001942 CAAGTTCTGACAATGACTCTGGG + Intronic
1073363214 10:102917233-102917255 CCAGTACTCCCAACGTCACCTGG - Intergenic
1074997149 10:118767356-118767378 TCAGATCTGCCTATGGCACCTGG - Intergenic
1076579491 10:131497126-131497148 CGTGTTCTGTCAAGGACACCTGG + Intergenic
1076723430 10:132402662-132402684 CCAGTTCTGGCTATGAGGCCAGG + Intronic
1076769351 10:132654542-132654564 CCAGCTCTGCCCAGGACCCCGGG - Intronic
1077542821 11:3155496-3155518 CCAGCTCTGCCACTCACCCCAGG + Intronic
1078226667 11:9398233-9398255 CCAGTTCTTCATATGACACGTGG - Intronic
1090920235 11:131200440-131200462 CCGATTCTGCCAATGGCTCCAGG - Intergenic
1094161747 12:27398018-27398040 CCAGTTCTGCCTGTGGCTCCAGG + Intronic
1095795948 12:46218871-46218893 CCAGTTCTGCCATTGCACCCAGG - Intronic
1095918593 12:47506034-47506056 CCAGTCCTGTCAATGCCTCCTGG - Intergenic
1096288055 12:50317197-50317219 CCAGCTCTCCCAATGATAGCAGG - Intergenic
1099425496 12:82518464-82518486 GCAGTTCTGCCAGTGAAGCCTGG + Intergenic
1102480715 12:113221480-113221502 CCACTTCAGCCACTGCCACCAGG - Exonic
1104880992 12:132070010-132070032 TCAGTTCTCCCAAAGACACCAGG - Intronic
1106440106 13:29759014-29759036 CCACTTCTGACAATGAAACTGGG + Intergenic
1107340083 13:39396318-39396340 GCAGTTTAGCCAATAACACCAGG - Intronic
1108226776 13:48297374-48297396 ACAGTTCAGCCCATGACACCTGG - Intergenic
1115893688 14:38060782-38060804 CAGGTTCCTCCAATGACACCTGG + Intergenic
1119177168 14:72577514-72577536 CCAGTTCTTACCATCACACCTGG + Intergenic
1120286446 14:82508014-82508036 CCGGTTCTTCCCATGACACATGG - Intergenic
1120702331 14:87711808-87711830 CCAGTTCTGGCCATGGGACCTGG + Intergenic
1122297386 14:100713125-100713147 CCAGTCCTGCCCACGCCACCTGG - Intergenic
1122824663 14:104363796-104363818 TCAGTACTGCCACTGACAGCTGG + Intergenic
1124348278 15:28936857-28936879 CCATTTCTGCCACTGGCCCCTGG - Intronic
1125593765 15:40871942-40871964 CCAGCTCTGGCGCTGACACCTGG + Intergenic
1133032315 16:3017377-3017399 CCAGTTCTCCCACCGCCACCTGG + Intronic
1133563127 16:6967975-6967997 GCAGTTCTGCTGATGACAGCGGG + Intronic
1135173143 16:20204219-20204241 CCAGTACTGTCAATAACAACTGG - Intergenic
1138006496 16:53342488-53342510 CCAGTTCTGCCATTGCACCCAGG + Intergenic
1138299350 16:55913258-55913280 CCAGTTCTGCCATTGCACCCAGG - Intronic
1138414759 16:56865226-56865248 GCAGTTCTGCCATTGTCGCCTGG - Exonic
1141611032 16:85181355-85181377 CCAGCCCTGCCAATGACGGCTGG - Intronic
1142169053 16:88610868-88610890 CCATCTGTGCCAACGACACCGGG + Intronic
1145000483 17:19301367-19301389 CCAGTTCTGCCCATAACCCCTGG + Intronic
1152115260 17:78382548-78382570 CCAGTTCTGCCACAGTCAACTGG - Intronic
1160179042 18:76618714-76618736 CCAGTTCAGCCATTGCCACGAGG - Intergenic
1160268361 18:77360828-77360850 CAGGTTCTTCCTATGACACCTGG + Intergenic
1160433264 18:78826917-78826939 CCAGCTCTGCACCTGACACCTGG + Intergenic
1161542661 19:4861337-4861359 CCGGTTCTTCCACTGTCACCTGG + Exonic
1162341681 19:10094992-10095014 CCATTTCTGCCCCTGAGACCAGG - Intronic
1164995534 19:32718468-32718490 CCAGTTCTGCCAAACCAACCAGG - Intergenic
1165395843 19:35563238-35563260 CCAGCTCCGCCACTGACAGCTGG + Exonic
926429198 2:12768575-12768597 TCAGATCTGCCAATGACATATGG - Intergenic
927879422 2:26680138-26680160 CCAGTTCTGCCACTGAACCCTGG - Intergenic
928643754 2:33328667-33328689 CTAGTTCTGCCCTTGACACATGG + Intronic
936290682 2:111221717-111221739 CCACCTCTGCCATTGATACCAGG + Intergenic
936577582 2:113668927-113668949 GCAGTATTGCCAATAACACCTGG + Intergenic
937382943 2:121397601-121397623 CCAGCTCTGCCACTGACTGCAGG + Intronic
939620176 2:144409473-144409495 GCAGTTCTTCCAAAGAGACCAGG - Intronic
944323515 2:198376681-198376703 ACAGTGCTGTTAATGACACCAGG + Intronic
946060913 2:216940845-216940867 CCAGCTCTGCCACTTATACCTGG + Intergenic
946221463 2:218231221-218231243 CCCCCTCTCCCAATGACACCAGG - Intronic
947452372 2:230220579-230220601 CCAGTTCTGCCTCAGACTCCTGG - Intronic
948077298 2:235174784-235174806 CCACTGCAGCCAATGGCACCAGG + Intergenic
948312815 2:237001789-237001811 ACAGTTCTGCCTATGACACATGG - Intergenic
1170478956 20:16745901-16745923 GCAGTTATGCCAAAGACACTGGG - Intergenic
1170930316 20:20763860-20763882 CCAGTTCTCCCAAGGAGCCCAGG - Intergenic
1171215115 20:23346778-23346800 ACAGTCCTGCCAAAAACACCTGG - Intergenic
1172872540 20:38144694-38144716 CCAGCTCTGCCACTAACCCCTGG - Intronic
1172943712 20:38672361-38672383 CCAGTTCTGCCACTCCCCCCAGG + Intergenic
1173600955 20:44294838-44294860 CCAGTTCTGCCATTCAACCCAGG - Intergenic
1174229576 20:49034235-49034257 CCAGTTCCACCCATGACATCTGG - Exonic
1175419214 20:58820857-58820879 CCAGTTCCTCCCATGACACGTGG + Intergenic
1176420030 21:6506689-6506711 CCAGTTCTGCCATTGTACCCAGG - Intergenic
1177583593 21:23060271-23060293 CCAGTTGGGCAAATGACACAAGG - Intergenic
1178495606 21:33083470-33083492 CCAGTGCTGCCAAGGCCACTGGG - Intergenic
1179144266 21:38753216-38753238 GCCCCTCTGCCAATGACACCTGG - Intergenic
1179695522 21:43115009-43115031 CCAGTTCTGCCATTGTACCCAGG - Intergenic
1180080234 21:45483319-45483341 CCAGGGCCGCCAAGGACACCCGG - Intronic
1181951069 22:26554298-26554320 CCAGTCTTGCCCCTGACACCTGG + Intronic
1184464823 22:44662651-44662673 CCAGTTCTGCCAGTGAGTGCTGG + Intergenic
1185335123 22:50267931-50267953 CCAGTTCGGCCTACGACGCCCGG - Exonic
949700578 3:6752341-6752363 CCAGTTCTGCCATTGGTAACTGG + Intergenic
949972083 3:9416764-9416786 CCAGTTGTGTCTATGACATCTGG - Intronic
951938666 3:28052689-28052711 CCAGTTGTGCCACTTACACCTGG - Intergenic
952755057 3:36858572-36858594 CCAGGCCTGCCCATGTCACCTGG - Intronic
953336593 3:42099090-42099112 CCACTTCTGCCAGCCACACCCGG - Intronic
956364329 3:68483532-68483554 CCCATTCTGCCCATGACAACTGG - Intronic
956872854 3:73435314-73435336 CCAGTCCAGGCAGTGACACCAGG - Intronic
957159145 3:76585786-76585808 CAAATTCTGCCAAACACACCTGG - Intronic
959297341 3:104553918-104553940 CCAGTTCTGCCATTGAAAAATGG + Intergenic
961522973 3:127478618-127478640 CCAGTTCTGCAGGTGCCACCGGG - Intergenic
965532894 3:169792596-169792618 TCAGTTCAGCCAAGGACAACTGG - Intergenic
969867271 4:10084110-10084132 CTACCTCTGCCAATGGCACCTGG - Intronic
970424457 4:15933564-15933586 CCAGTTCTGCCAGTGACCAGAGG + Intergenic
976193005 4:82506876-82506898 CTAGGTCTGCCAATGAAACAGGG + Intronic
978032182 4:103948804-103948826 CCAGTTCTGCCATTGCACCCAGG - Intergenic
985531515 5:436421-436443 CCAGTCCTGCCAACCAAACCTGG - Exonic
985857253 5:2439275-2439297 CCAGTTCTGCCACTCCCACTAGG + Intergenic
989138639 5:38180572-38180594 CCAGTTCTGTCATTCACAGCTGG + Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
998618212 5:143764602-143764624 CCAGTCCTGCCCTTGACACATGG + Intergenic
998926212 5:147128997-147129019 CCAGTCCTGCCCTTGACACATGG + Intergenic
999121458 5:149212707-149212729 CCAGTTCTGCCAATGACACCAGG - Intronic
1001396746 5:171423371-171423393 TGAGCTCTGACAATGACACCGGG + Intronic
1002078922 5:176726419-176726441 CCAGCACTGCCGAGGACACCAGG + Intergenic
1003564190 6:7208564-7208586 CCAGTTCTCCCACTGAGCCCCGG - Intronic
1007879506 6:45147650-45147672 CCACCTCTTCCTATGACACCAGG - Intronic
1010929888 6:81789013-81789035 ACAGTTCTGCCAATGTTACATGG + Intergenic
1014069598 6:117166310-117166332 CCAATTCTGATAATGACCCCTGG - Intergenic
1017205169 6:151797161-151797183 CCACCTCTGCCCATGAGACCCGG - Intronic
1018798362 6:167204185-167204207 CAAGGTCTGCTAATGAGACCAGG - Intergenic
1018814352 6:167319991-167320013 CAAGGTCTGCTAATGAGACCAGG + Intergenic
1019147173 6:169982995-169983017 CCAGTTCTGCCAGTGTGACTGGG - Intergenic
1027506148 7:79019258-79019280 CCAGTCCTGCCCTTGACACGTGG - Intronic
1030367649 7:108663607-108663629 TCAGTTGTGCTAATGACAACTGG - Intergenic
1031997405 7:128241583-128241605 TCAGCTCTGCGAATGCCACCAGG - Intronic
1034538087 7:151738315-151738337 CCAGATCTGCCACTCACACGGGG + Intronic
1034835471 7:154347867-154347889 CCAGCCCTGCCAATGAATCCTGG + Intronic
1034860155 7:154587918-154587940 GCAGGACTGCCAATGGCACCAGG + Intronic
1041975618 8:63795872-63795894 CCAGTTCTACCAAGGAATCCTGG + Intergenic
1045893289 8:107183219-107183241 CCAGTTCTGATAATTACACATGG + Intergenic
1047077065 8:121415943-121415965 CAAGTTCTGCCAACTACACCAGG + Intergenic
1050018701 9:1261921-1261943 CCATTTCTTCCCAGGACACCAGG + Intergenic
1050119719 9:2295917-2295939 CCAATTCTGACAATTTCACCTGG - Intergenic
1052368630 9:27640710-27640732 CCCTATCTGCCACTGACACCTGG - Intergenic
1052483106 9:29057512-29057534 CCAGTTCAGAAAGTGACACCAGG - Intergenic
1053886382 9:42647235-42647257 ACAGTGCTGCCACTCACACCTGG - Intergenic
1054225402 9:62454684-62454706 ACAGTGCTGCCACTCACACCTGG - Intergenic
1057050217 9:91917836-91917858 CAAGCTCACCCAATGACACCTGG + Intronic
1059769086 9:117411082-117411104 CCAGGTCTGCCATTGATTCCTGG + Intronic
1061462101 9:130748036-130748058 CCAGTTCAGCCGAGGATACCAGG - Intronic
1061817269 9:133204893-133204915 CCAGTGCTGCCACTGAGCCCAGG + Intergenic
1061923780 9:133796112-133796134 CCATTTCTGCCATGGCCACCAGG + Intronic
1062243139 9:135550331-135550353 CCAGTGCTGCCACTGAGCCCAGG - Intergenic
1185812717 X:3125609-3125631 TCAGATCTGCCAGTGGCACCAGG - Intergenic
1185917582 X:4052888-4052910 TCAGTTCTCCCAGTGACTCCAGG + Intergenic
1187208523 X:17206203-17206225 ACAGTTATGCTAATGAAACCAGG - Intergenic
1190873775 X:54445722-54445744 CCAGCTCTGCCACTGACCCTGGG - Exonic
1193881614 X:86929740-86929762 CCAGTCCTGCCCTTGACACTTGG - Intergenic
1195440842 X:104896314-104896336 CAACTTCTGCCAAGGACCCCTGG + Intronic
1197720467 X:129741356-129741378 CCTGTTCTACCACTGACTCCTGG + Intronic