ID: 999121737

View in Genome Browser
Species Human (GRCh38)
Location 5:149215024-149215046
Sequence CAGTTTGAGCAAAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999121737_999121742 1 Left 999121737 5:149215024-149215046 CCTACCTCCCTTTGCTCAAACTG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 999121742 5:149215048-149215070 TTTCAACACCATCCAAGACTGGG 0: 1
1: 0
2: 0
3: 6
4: 124
999121737_999121746 14 Left 999121737 5:149215024-149215046 CCTACCTCCCTTTGCTCAAACTG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 999121746 5:149215061-149215083 CAAGACTGGGGCTGCTGAGATGG 0: 1
1: 0
2: 3
3: 36
4: 290
999121737_999121747 15 Left 999121737 5:149215024-149215046 CCTACCTCCCTTTGCTCAAACTG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 999121747 5:149215062-149215084 AAGACTGGGGCTGCTGAGATGGG 0: 1
1: 0
2: 1
3: 28
4: 365
999121737_999121743 2 Left 999121737 5:149215024-149215046 CCTACCTCCCTTTGCTCAAACTG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 999121743 5:149215049-149215071 TTCAACACCATCCAAGACTGGGG 0: 1
1: 0
2: 0
3: 12
4: 125
999121737_999121741 0 Left 999121737 5:149215024-149215046 CCTACCTCCCTTTGCTCAAACTG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 999121741 5:149215047-149215069 TTTTCAACACCATCCAAGACTGG 0: 1
1: 0
2: 0
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999121737 Original CRISPR CAGTTTGAGCAAAGGGAGGT AGG (reversed) Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
901328092 1:8381243-8381265 CAGTCGGAGGAAAGGGAGGAGGG - Intronic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
904932418 1:34099873-34099895 CAATTTCAGCAAAGGCAGGTGGG + Intronic
905839551 1:41163021-41163043 CAGTTTGGGCAAAGAGAAGGAGG + Intronic
906049249 1:42857030-42857052 CAGAGTCAGCAAAGGGAGATAGG - Intergenic
906729680 1:48070464-48070486 AAGTTTGACCAAAGGCATGTTGG + Intergenic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
908856497 1:68435640-68435662 CAGTTTGAGGAAAGACAGATAGG - Intronic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
909692391 1:78423417-78423439 AAGCTTGAGCAAAGTGAGGAAGG - Intronic
910139235 1:84008373-84008395 CAGTTAGACCTAAGGGAGATAGG - Intergenic
910364321 1:86447993-86448015 ATGTTTGAGCAAAGGGTGGGAGG + Intronic
910679550 1:89848383-89848405 AAGTTTAAGGAAAGGGAGATAGG + Intronic
911005937 1:93224246-93224268 CGGTTTGGCAAAAGGGAGGTGGG - Intronic
912546654 1:110456189-110456211 CACCTTCACCAAAGGGAGGTAGG - Intronic
912566754 1:110592903-110592925 GAGTATGAGCACAGGGAAGTCGG - Intergenic
912609694 1:111030342-111030364 CAGTTTGAGCCACTGGAGCTGGG - Intergenic
912708997 1:111936495-111936517 CAGTAAGAGCAAAGGGTGCTGGG + Intronic
914805449 1:150987999-150988021 CAGTTTGGGCTGAGGAAGGTGGG + Intronic
915939327 1:160108831-160108853 AAGTTTGAGGAAATGGAAGTGGG + Intergenic
916675167 1:167059374-167059396 CAGCTGGAGCAGAGGAAGGTGGG - Intronic
917253825 1:173092733-173092755 CATTTTGCGCAAAAGGAGATTGG + Intergenic
918475240 1:184917570-184917592 AAGTCTGAGTAAAGGGAGGGTGG - Intronic
918845076 1:189599352-189599374 CAGGTTCAGCAACGGGAGATTGG + Intergenic
920911951 1:210227191-210227213 CAATTTGAGGAAAGGCACGTAGG - Intergenic
922460494 1:225811338-225811360 AAGTTTAAACAATGGGAGGTGGG - Intronic
923562202 1:235049838-235049860 GAGTGTGGGGAAAGGGAGGTGGG + Intergenic
923706173 1:236346616-236346638 AAGTGTGTGCAAAGAGAGGTGGG - Intergenic
923815024 1:237367967-237367989 CAGTCTGATCAAGGGGAGGAGGG + Intronic
924331614 1:242945998-242946020 CAAATTGAGCCAAGGGAGATGGG - Intergenic
924371338 1:243353582-243353604 CAGCTTGAGCAAAGGAATGGGGG + Intronic
1063001536 10:1928681-1928703 CCATTAGAGCAAAGGGAGGAGGG + Intergenic
1063555137 10:7071671-7071693 CATTTTGAGAATAGGGTGGTTGG - Intergenic
1065114803 10:22475088-22475110 CAGTAGGAGAAACGGGAGGTGGG + Intergenic
1067099622 10:43325144-43325166 CAGTGTGAGCCATGGGTGGTGGG + Intergenic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1068113289 10:52706924-52706946 CAGTTTAAGCTAATGAAGGTAGG - Intergenic
1071007106 10:80895434-80895456 CAGTCTGTGGAACGGGAGGTAGG - Intergenic
1071300875 10:84255249-84255271 CGATCTGAGCAAAGGGAGGGTGG - Intronic
1071908265 10:90199452-90199474 AATTTTGAGAAAAGGGAGATAGG + Intergenic
1071915887 10:90295297-90295319 AAGAGTCAGCAAAGGGAGGTAGG - Intergenic
1074598385 10:114888411-114888433 CAGTTTGGGGAAGTGGAGGTAGG + Intronic
1075724271 10:124603623-124603645 CAGGTTGGGCAAGGGGAGGGCGG + Intronic
1077682053 11:4250938-4250960 GAGTGTCAGCAAAGGGAGATAGG - Intergenic
1079413292 11:20209406-20209428 CATTTTGAGCAAATGGAAGGGGG + Intergenic
1079451990 11:20605640-20605662 GAGTTCCAGCAAAAGGAGGTTGG + Intronic
1079968336 11:27005892-27005914 CAGGTTGAGGGTAGGGAGGTGGG + Intergenic
1082579082 11:54844492-54844514 CAGAGTCAGCAAAGGGAGATAGG + Intergenic
1083433187 11:62625562-62625584 CAGTTAGAGCAACAGGATGTTGG + Exonic
1084887435 11:72220284-72220306 CATTTTGAGCAAAGGAAGAGAGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1086147774 11:83572393-83572415 AATTTTGAGAAAAGGAAGGTTGG + Intronic
1087405405 11:97723219-97723241 CAGTTGTGGCTAAGGGAGGTGGG - Intergenic
1087863837 11:103198267-103198289 CATTTTGGGCAAAGGTATGTTGG + Intronic
1091066089 11:132514660-132514682 CAGTTGGAACAAAGGCAGTTTGG - Intronic
1091738933 12:2946144-2946166 CAAAGTGAGGAAAGGGAGGTAGG - Intergenic
1093595178 12:20950756-20950778 CAGTTTGAGCAACTGGAGCCAGG + Intergenic
1093759631 12:22893279-22893301 CAGTTTAAGGTAAGAGAGGTAGG - Intergenic
1094182242 12:27604195-27604217 CAGTTGGAGAAAATGGAGATAGG + Intronic
1094227951 12:28067456-28067478 CAGTTGGAGCCACGGAAGGTGGG + Intergenic
1095176164 12:39094936-39094958 CAGTTTGAGCAAATTTAGGTAGG - Intergenic
1095254887 12:40023032-40023054 CAGATTGAGTAAAGGAAGGCAGG - Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1096595176 12:52690601-52690623 CAGGTACAGCAAAGGGAGCTTGG + Exonic
1096680692 12:53253336-53253358 CAGCTCGAGCAAAGGTAGCTGGG - Exonic
1097028217 12:56074219-56074241 CAATTTGGGCAAACTGAGGTGGG - Intergenic
1098140350 12:67444479-67444501 CAGGTTGAACAAAAGGAGCTAGG + Intergenic
1101653175 12:106695946-106695968 GAGTTTAAGGAAAGGAAGGTGGG - Intronic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102896142 12:116599883-116599905 CATTTTGGGACAAGGGAGGTGGG - Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103044198 12:117721812-117721834 CCCTTTAAGCAGAGGGAGGTGGG + Intronic
1103142258 12:118558921-118558943 AAGATTGAGCAAAAGGAGTTTGG - Intergenic
1105245404 13:18645682-18645704 CATTTTGAGGAAAGGGAGTCAGG - Intergenic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1107873154 13:44765180-44765202 CATTTTGAGTAAAGGGAGTCAGG + Intergenic
1108747735 13:53412078-53412100 CAGCTTGAGCAAAGGCATCTAGG + Intergenic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1112718655 13:102216336-102216358 CACTTTGAGGAAATGGAGTTTGG - Intronic
1114212192 14:20624865-20624887 CAGTTTGAGCAAGGAGAGGTTGG - Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1117253170 14:53954811-53954833 CAGCCTCAGGAAAGGGAGGTCGG - Intronic
1118401213 14:65381177-65381199 TAGTGAGAGCAAAGGGAGATGGG - Intergenic
1120095655 14:80384743-80384765 CAGTTTGAAGAACTGGAGGTAGG + Intronic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122507372 14:102240204-102240226 CAGAGTCAGCAAAGGGAGATAGG - Intronic
1122589471 14:102836636-102836658 CAGTTGTAGCAAGGTGAGGTGGG + Intronic
1129312456 15:74722247-74722269 CAGTCTGGGGAAAGGCAGGTGGG - Intronic
1129376854 15:75138971-75138993 CTGTTTGTGCAAAGGGACATGGG - Intergenic
1129771377 15:78205424-78205446 CAGTTAGATGAAAGGGAGGCAGG + Intronic
1129797522 15:78389405-78389427 CAGTTTGAGAGGAGGGAGCTGGG - Intergenic
1131039120 15:89245691-89245713 CAGAGTGATGAAAGGGAGGTAGG + Intronic
1131317385 15:91351929-91351951 GAGTGTGAGCAAGGGGAGGCTGG + Intergenic
1135499422 16:22980893-22980915 TAGTTTGAACAAGGGGAAGTGGG - Intergenic
1135705183 16:24668876-24668898 CACTCTGTTCAAAGGGAGGTTGG - Intergenic
1135914620 16:26594631-26594653 CATTTTGTGCAAAGTGAGCTAGG - Intergenic
1136381723 16:29899214-29899236 GAGACTGAGCAAAGGGGGGTGGG - Exonic
1136529693 16:30859759-30859781 CAGAATCAGCAAAGGGTGGTGGG - Intronic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1139435645 16:66935131-66935153 CCGCTTGAGCAAAGGCAGGAAGG - Exonic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1140535129 16:75702970-75702992 GAGAGTGAGCAAAGGGTGGTGGG + Intronic
1142761113 17:2042368-2042390 CAGTTTGAGCAAAGAGGGTATGG - Intronic
1143123742 17:4627252-4627274 CTATTTGAGCAAAGGGTGATAGG - Intergenic
1143275348 17:5705887-5705909 CAGTTTGGGCTGAGGAAGGTGGG + Intergenic
1144078202 17:11737797-11737819 CAGATGGAGCAAAGGTAGGCTGG - Intronic
1144101626 17:11946801-11946823 CAGGTTGAGCATAGGGAGACAGG + Intronic
1145305434 17:21671716-21671738 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1146599224 17:34199975-34199997 GAGTTTGAGAGAAGGTAGGTCGG + Intergenic
1146765857 17:35520914-35520936 CACTTTGAGAGAAGGGAGGATGG - Intronic
1147836104 17:43332967-43332989 GAGTTTGAGGAAAGGTAGGAGGG + Intergenic
1148994804 17:51700430-51700452 GAGCATGAGCAAACGGAGGTGGG - Intronic
1149408414 17:56378641-56378663 CTGTTTGGGGAAAGAGAGGTGGG + Intronic
1149771848 17:59328705-59328727 CAGTTTGAGCAAAGGACAGATGG + Intergenic
1150860743 17:68797701-68797723 GAGTGTCAGCAAAGGGTGGTGGG + Intergenic
1153496340 18:5703657-5703679 AAGTTGGAGCAATGGGTGGTGGG + Intergenic
1154337291 18:13475901-13475923 GAATTTGAGCAAAGGGATGGAGG + Intronic
1154443540 18:14414265-14414287 CATTTTGAGGAAAGGGAGTCAGG + Intergenic
1155247979 18:23928534-23928556 CAGTTTGAGTAAAGTGAGATAGG + Intronic
1158859708 18:61580460-61580482 TTGTTTGAGCAAAGGAAGGTGGG - Intergenic
1159798635 18:72869942-72869964 AAGCTTGAGCAAAGGGAGAGAGG + Intergenic
1161708300 19:5832735-5832757 GTGTTTGAACAAAGGGAGCTTGG + Intronic
1161827359 19:6577180-6577202 GAGTGTCAGCAAAGGGAGATGGG - Intergenic
1162184251 19:8892344-8892366 CAACTGGAGGAAAGGGAGGTGGG + Intronic
1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG + Intronic
1163758102 19:19118944-19118966 CAGTTTGAGGAATGGGAGGGCGG - Intergenic
1164151514 19:22556966-22556988 CAGCTGGAGCAGAGGGAGCTAGG - Intergenic
1165274057 19:34733206-34733228 CAGATTGTGCAAAGTGAGGAAGG + Intergenic
1165795125 19:38514946-38514968 CTATTTGAGACAAGGGAGGTGGG + Intronic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1168461482 19:56562643-56562665 TAGTTTGAGTAAGAGGAGGTGGG + Intergenic
925830169 2:7886100-7886122 CAGTTTGGGCATAGGGTGGCAGG + Intergenic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
926547558 2:14260634-14260656 CAGCTTGAGGAAAGGGATGAGGG + Intergenic
926695609 2:15768336-15768358 CAGTTTCTGTAAAGTGAGGTTGG - Intergenic
927139790 2:20122010-20122032 AAGTTTGAGCAAGGGGATGAAGG - Intergenic
929151031 2:38749605-38749627 CATTTGGATCAAAGGGACGTCGG + Exonic
929384305 2:41385597-41385619 GAGAGTCAGCAAAGGGAGGTAGG - Intergenic
930667967 2:54118083-54118105 ATGATTGTGCAAAGGGAGGTAGG + Intronic
930704654 2:54492531-54492553 CAGTTGGTGCAAAGGGCAGTAGG - Intronic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931478225 2:62611829-62611851 CGATTTGTGTAAAGGGAGGTGGG - Intergenic
932599086 2:73111973-73111995 CCCTTTGAGGAAAGGGAGGCAGG + Intronic
935663833 2:105492887-105492909 CAGATAGAGAAAATGGAGGTGGG - Intergenic
936011041 2:108925445-108925467 CATTTTGAGCATGGGGAGGGTGG + Intronic
936935617 2:117836225-117836247 CAGCTTGAGGAAAGAAAGGTCGG + Intergenic
937381587 2:121382263-121382285 TAGGCTGAGAAAAGGGAGGTGGG + Exonic
937424343 2:121785924-121785946 GGGTTAGAGCAAAGAGAGGTAGG + Intergenic
938194372 2:129314111-129314133 AAGTTTGGGCAAAAGCAGGTGGG + Intergenic
938664198 2:133517489-133517511 CAGCTTGAGAAAAGGGACTTTGG - Exonic
939100591 2:137890805-137890827 CATTTTGAGGAAAGGGAGTTAGG - Intergenic
939460247 2:142489773-142489795 CAGAGTCAGCAAAGGGAGATGGG + Intergenic
940087070 2:149872234-149872256 CAGCTTAAGCAAAGGGATCTGGG - Intergenic
944202224 2:197119954-197119976 CAGCATGAGCAAAGAGGGGTGGG - Intronic
945420473 2:209630006-209630028 CTGTTTGACCAAATGGAGATAGG + Intronic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
946173948 2:217911339-217911361 CAGTTAGAGCAAAGCAAGGTGGG + Intronic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
947126150 2:226870429-226870451 AAGTAGGAGCAAAGGGAAGTAGG - Intronic
947435836 2:230071277-230071299 GAGTTTCAGCATATGGAGGTAGG + Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1169062612 20:2672566-2672588 GAGTTTAAGCAACGAGAGGTAGG + Intergenic
1169943261 20:10960922-10960944 TAGTTTGATCAAAGGGAGAAGGG - Intergenic
1172481371 20:35273874-35273896 CTGCTTGAGCCAAGGGAGGCAGG - Intronic
1172649486 20:36492775-36492797 CATTTTGAGCAAATTGAGGTTGG + Intronic
1173665041 20:44757261-44757283 CAGAGTGAGCAAAGGAAGGGTGG - Intronic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1174424522 20:50422705-50422727 CAGTTTGTGCAAAGGGCTGGAGG + Intergenic
1174680086 20:52398314-52398336 CAGCTTGAGCCAAGGGAGCTGGG + Intergenic
1174970247 20:55267170-55267192 CAGCTTGAGAAAAGGGGGCTGGG + Intergenic
1175362324 20:58422383-58422405 GAGATTGAAGAAAGGGAGGTTGG + Intronic
1176452549 21:6876973-6876995 CATTTTGAGGAAAGGGAGTCAGG - Intergenic
1176830722 21:13742022-13742044 CATTTTGAGGAAAGGGAGTCAGG - Intergenic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1181809451 22:25394582-25394604 CAGTCTGGGCCATGGGAGGTTGG + Intronic
1182385874 22:29940399-29940421 AAGATTCAGCAAAGGGTGGTAGG - Intronic
1183573970 22:38675217-38675239 CAGTGAGAGCAAAGGGAGCCTGG - Intergenic
1183843423 22:40519519-40519541 CAGTTTGGACACAAGGAGGTTGG - Intronic
951666315 3:25127707-25127729 CATTTTGATCAAAGGTAGCTGGG - Intergenic
952965179 3:38616721-38616743 CAGAAAGAGCAAAGGGTGGTGGG + Intronic
953673194 3:44979842-44979864 CAGTTTGTGAGAAGGGAGGGTGG + Intronic
956078977 3:65537215-65537237 TAGCTTGAGCAAAGGCATGTTGG - Intronic
957060208 3:75475428-75475450 AAGTGTGAGCGAAGGGAGATAGG + Intergenic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
959681726 3:109104260-109104282 CAGTTTGAGCAAAGGATCCTGGG - Intronic
960309644 3:116105454-116105476 CAGAGTCAGCGAAGGGAGGTAGG + Intronic
961530136 3:127535659-127535681 ATGTTTGACCAAAGGGAGGAAGG - Intergenic
962665367 3:137648927-137648949 CAGTTTGAGCAAAGGTACACAGG - Intergenic
962976814 3:140452850-140452872 CATGTAGAGCAAAGGAAGGTGGG - Intronic
963297550 3:143562385-143562407 CAGTAAGAGCAAAGGGAGAGAGG + Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
964305955 3:155340053-155340075 AAGTTTGAGGAAAGGGTAGTTGG - Intergenic
965616392 3:170597231-170597253 CAGGTTGAGCTAAGGGGAGTTGG - Intronic
967868500 3:194210103-194210125 CTCTTTGGGCAAAGGGTGGTGGG - Intergenic
969367191 4:6703364-6703386 CAGTTTGAGCAGGGAGAGATGGG - Intergenic
969663895 4:8545854-8545876 CAGCTTCAGCACACGGAGGTGGG - Intergenic
969809807 4:9639207-9639229 AAGAGTGAGCAAAGGGAGATAGG - Intergenic
971833537 4:31731844-31731866 CAGTTTTAGAAAAGGAAGGAAGG - Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
973258585 4:48137905-48137927 CAGCTTGAGCAAAGGTAAGGAGG - Intronic
973854885 4:55001379-55001401 CAGTTAGAGAAAAGGGAGTGAGG + Intergenic
975431718 4:74300016-74300038 CAGTTAGAGCAAAGGAAGAAAGG + Intronic
976828320 4:89284654-89284676 CAGGGTGAGAAAAGGGAGCTAGG - Intronic
978204424 4:106063577-106063599 GAGCTTGAGCAAAGGGGGGAAGG + Intronic
979500991 4:121439709-121439731 CAGTTGGAGCCAGGTGAGGTGGG + Intergenic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
981568944 4:146131521-146131543 CAGTGAGAGCACTGGGAGGTAGG - Intergenic
983249259 4:165326555-165326577 CAGTTTGAGCAAAAGCATGGAGG + Intergenic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
986709888 5:10480927-10480949 CAGTTTGAGCAGGGGGAGACAGG + Intergenic
987922581 5:24302894-24302916 CAGTTTGACAATAGGAAGGTGGG - Intergenic
988551555 5:32204934-32204956 GAGCTTTAGTAAAGGGAGGTGGG + Intergenic
989602931 5:43216703-43216725 CAGTTTGAGCAAAGACCAGTAGG + Intronic
989689161 5:44119837-44119859 GAGTGTCAGCAAAGGGAGATGGG + Intergenic
989998934 5:50869971-50869993 CAGATTGGCCAAAGGAAGGTAGG - Intergenic
991202289 5:64008475-64008497 CAGTTTGTGCACTGGGAGGATGG + Intergenic
993926289 5:93870202-93870224 TAGTTTCACCAAAGGGAGGAGGG + Intronic
995511890 5:112918772-112918794 CTGTGTGAGCAAAGAGTGGTGGG - Intronic
995897852 5:117035813-117035835 CAAATTTAGAAAAGGGAGGTTGG - Intergenic
996388370 5:122933427-122933449 GAGTTTAAGGAAAGGGAGCTGGG - Intronic
996795240 5:127339147-127339169 AAATTTGATCAAAGGGATGTGGG - Exonic
997365715 5:133324027-133324049 ATTTTTGAGCAAAGGGAGATAGG + Intronic
997712366 5:136016413-136016435 GAGGTTGAGGAAAGGGAAGTAGG - Intergenic
998847775 5:146327558-146327580 CAGCTTTAGCAAAGGGAAGGAGG - Intronic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
999475907 5:151898712-151898734 CAGATTGAAGACAGGGAGGTGGG + Intronic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1005716295 6:28552371-28552393 CAGTTTGAGGAAATGGTAGTGGG + Intergenic
1005938395 6:30542475-30542497 CAGTTTATGCAAATGGAGCTTGG - Exonic
1006275523 6:33002241-33002263 TAGTTTGTGCAAAGGCAGGGAGG + Intergenic
1006289116 6:33120946-33120968 CAGTTTGAGCCACTGGAGCTGGG + Intergenic
1006425490 6:33960463-33960485 CAGTCTGAGGGAAGAGAGGTTGG - Intergenic
1007234062 6:40378064-40378086 CTGTTGGGGCTAAGGGAGGTGGG - Intergenic
1007649090 6:43406553-43406575 CAGTTTCAGCAGAGCGATGTGGG + Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1010124960 6:72420866-72420888 CAGTTAGAGGAAATGAAGGTGGG + Intergenic
1011643217 6:89433693-89433715 CAGTTTGAAGGAAGGGCGGTGGG + Intronic
1013572723 6:111445860-111445882 CAGTTTAAGCAAAGGTATGGGGG + Intronic
1014215386 6:118747956-118747978 CTGTTAGAGCAAAGGAAGGTAGG - Intergenic
1014382738 6:120763855-120763877 CAGTTACAGGAAATGGAGGTTGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1021263585 7:18490793-18490815 TAGTTTGAGGAATGTGAGGTTGG + Intronic
1021339169 7:19442022-19442044 CAGTTGAAGCATAGGGAAGTTGG + Intergenic
1021800939 7:24305666-24305688 AAGATTGAGGAAGGGGAGGTAGG + Intergenic
1021914965 7:25422223-25422245 CAGTTTGAGGAAAGTGAGTTGGG + Intergenic
1025283382 7:57644113-57644135 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1025566057 7:62435379-62435401 CTGTTAGGGCATAGGGAGGTTGG + Intergenic
1027403577 7:77834562-77834584 CAGTCTGAGCCATGTGAGGTAGG - Intronic
1029799359 7:102930011-102930033 CAGTTTGGGCTAGGGGTGGTGGG + Intronic
1032271772 7:130415158-130415180 CATTATTAGCAAAGGGAAGTTGG + Intronic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1033633361 7:143183846-143183868 CAGTTTGAGGAAAAGGGGGTAGG - Exonic
1038660209 8:29490636-29490658 CTGTTGGAGGAAAGGCAGGTGGG + Intergenic
1038831984 8:31072060-31072082 CAGTTTGAGTTAAGAGAGTTGGG + Intronic
1038905653 8:31899306-31899328 CAGTTGGGACAAAGAGAGGTAGG - Intronic
1041790784 8:61694099-61694121 CAGTTTGAGTATGAGGAGGTAGG - Intronic
1042722267 8:71839418-71839440 GAGTTTGAGAAATGGGAGTTGGG - Intronic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1043511254 8:80952518-80952540 GAGGGTGAGCAAAGGAAGGTGGG + Intergenic
1044507190 8:93035730-93035752 TAGTCTGTGCAAAGTGAGGTTGG - Intergenic
1044698344 8:94944971-94944993 CAGTTTTAGCAATGGGGGGAGGG - Intronic
1049536552 8:143185331-143185353 GATTTTGAGCAATGGGAGGGAGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1052480635 9:29020828-29020850 TAATTTGAGCAAAGGGTGGGGGG + Intergenic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1054261885 9:62875127-62875149 CAGCTTGAACTAAGGGAGGGAGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056986337 9:91366738-91366760 CAGTTTGGGAAAAGGCGGGTAGG + Intergenic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059929456 9:119246708-119246730 CAGTATGAGAGAAGGGAGGTGGG - Intronic
1060602428 9:124887067-124887089 CAGTCTGAGGAAAGGGAGAGAGG + Intronic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1062460779 9:136661776-136661798 CAACTTGAGCCAAGGGAGGCTGG - Intronic
1203516632 Un_GL000213v1:7542-7564 CATTTTGAGGAAAGGGAGTCAGG + Intergenic
1187439230 X:19302853-19302875 AAGTTGGAGTAAAGAGAGGTGGG - Intergenic
1187441903 X:19328256-19328278 CACGTTCAGCAAAGGCAGGTTGG - Intergenic
1188181877 X:27066317-27066339 GAGTTCCAGCAAAGGGATGTGGG - Intergenic
1188911107 X:35848937-35848959 TAGTTTGAGGATAGGGAGCTGGG - Intergenic
1191972260 X:66829596-66829618 CAGTTTTAGCCCAGGGAGGATGG - Intergenic
1193000015 X:76553425-76553447 CAGTTTGAGCCATTGGAGCTAGG + Intergenic
1193096432 X:77554602-77554624 CAGTTTGGGCAAAGGGACAGAGG - Intronic
1193596029 X:83446437-83446459 CAGTTGTAGCTAAGGCAGGTGGG - Intergenic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197713241 X:129687231-129687253 CATTTTGATCAAATGTAGGTGGG - Intergenic
1200707220 Y:6453303-6453325 GAGTTTGTTTAAAGGGAGGTGGG - Intergenic
1201026892 Y:9711405-9711427 GAGTTTGTTTAAAGGGAGGTGGG + Intergenic
1201228951 Y:11845163-11845185 CAAATTGAGCCAAGGGAGATGGG - Intergenic
1201860915 Y:18596371-18596393 TGGCTTCAGCAAAGGGAGGTAGG + Intergenic
1201872408 Y:18724009-18724031 TGGCTTCAGCAAAGGGAGGTAGG - Intergenic
1202062550 Y:20903017-20903039 GAGAGTGAGCAAAGGGAGATGGG + Intergenic