ID: 999122017

View in Genome Browser
Species Human (GRCh38)
Location 5:149217061-149217083
Sequence AGGTCGGAAGGCCTTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999122017_999122025 26 Left 999122017 5:149217061-149217083 CCCTCTGTAAGGCCTTCCGACCT 0: 1
1: 0
2: 1
3: 1
4: 79
Right 999122025 5:149217110-149217132 CTTCAGGTTCAGTGTTATCTTGG 0: 2
1: 0
2: 1
3: 12
4: 203
999122017_999122024 10 Left 999122017 5:149217061-149217083 CCCTCTGTAAGGCCTTCCGACCT 0: 1
1: 0
2: 1
3: 1
4: 79
Right 999122024 5:149217094-149217116 GGAAAGGAGATGCGATCTTCAGG 0: 1
1: 0
2: 0
3: 18
4: 267
999122017_999122022 -6 Left 999122017 5:149217061-149217083 CCCTCTGTAAGGCCTTCCGACCT 0: 1
1: 0
2: 1
3: 1
4: 79
Right 999122022 5:149217078-149217100 CGACCTGCTCATGACTGGAAAGG 0: 1
1: 0
2: 1
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999122017 Original CRISPR AGGTCGGAAGGCCTTACAGA GGG (reversed) Intronic
900990092 1:6094643-6094665 ATGTCTGTAGGCCTTGCAGACGG + Intronic
912250524 1:108007688-108007710 AGGTCTGATTGCCTAACAGATGG + Intergenic
914874480 1:151502532-151502554 AGGTCAGAGGGCCTTTCTGATGG - Intergenic
1070690176 10:78518492-78518514 AGGTCGGAGGGGCTAGCAGAAGG + Intergenic
1077889766 11:6410755-6410777 AGGCCCCAAGCCCTTACAGATGG - Exonic
1078141854 11:8699026-8699048 AGGTCTGGAGGCCTGGCAGAGGG - Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1084089396 11:66870235-66870257 AGGCCGGCAGGCCTCACAGTGGG - Intronic
1088946288 11:114516760-114516782 AGGTGGGAAAGCATTCCAGAAGG - Intergenic
1090661892 11:128888382-128888404 AGGTCTGAAGGACTTAGGGAAGG - Intergenic
1091179845 11:133594634-133594656 AAGTCTGAAGGCCTGAGAGAGGG + Intergenic
1096797292 12:54085844-54085866 AGGTAGGAAGCCCATCCAGAGGG + Intergenic
1112847156 13:103657802-103657824 AGGACAGAAAGCCTCACAGAGGG - Intergenic
1113187797 13:107709428-107709450 TGATCTGAAGGCCTGACAGAGGG - Intronic
1114537158 14:23430259-23430281 AGGAGGGAAGGCCATGCAGACGG - Intronic
1117311225 14:54525178-54525200 AGGAAGGAAGGCCTTGCAGCTGG - Intronic
1119351776 14:73971742-73971764 AGCTCAGAAGGCCTATCAGAAGG - Intronic
1122102360 14:99423145-99423167 AGGTGTAAAGGCCTTTCAGAGGG + Intronic
1125843034 15:42823496-42823518 CAGTCAGAAGGCATTACAGAGGG - Intronic
1126876257 15:53045048-53045070 AGGTGGGAAGGGCTGACTGATGG - Intergenic
1127814081 15:62591460-62591482 AGGTCAGAGGGCCATACAGAAGG + Intronic
1132161618 15:99548197-99548219 AGGTCCGAAGGCCTTTCATCAGG + Intergenic
1137838244 16:51615332-51615354 ATTTCGGAAGCCCTTTCAGAGGG - Intergenic
1141850960 16:86645687-86645709 AGGTGGGCAGGGCTAACAGATGG - Intergenic
1142942564 17:3394951-3394973 AGGTCGGCAGAACATACAGAAGG + Intergenic
1152864731 17:82716054-82716076 AGGTCGGAAGGCCTCAGAAGCGG + Intergenic
1153012906 18:555964-555986 TGGTCTGAAGCCCTTTCAGAAGG - Intergenic
1153033437 18:736201-736223 AGATAGGAAGGCATTCCAGATGG + Intronic
1153724797 18:7943588-7943610 AGGTCAGAAGCCCTAAAAGAAGG + Intronic
1157207145 18:45710351-45710373 AGGTCAGCTGGCCTCACAGAAGG - Intergenic
1160000762 18:75019604-75019626 AGGTGGGGAGCCCTTACAGCGGG - Intronic
1166060064 19:40320553-40320575 GGATAGGAAGGCCTTGCAGAAGG - Exonic
1167366904 19:49059170-49059192 AGGTGGGCAGGCCTGGCAGAGGG - Intronic
926695270 2:15766462-15766484 AGGGCGGAAGGGGTTACAGGAGG - Intergenic
927964721 2:27262062-27262084 AGGTCGGACGGCCGCTCAGAGGG + Intronic
933886596 2:86723462-86723484 AGGTCCAAAGTCCTGACAGAGGG - Intronic
933923584 2:87073243-87073265 AGGTCCAAAGTCCTGACAGAGGG + Intergenic
935093129 2:99916258-99916280 AGGACGGGAGGGATTACAGATGG - Intronic
935263170 2:101372056-101372078 TGGATGGAAGGACTTACAGATGG + Intronic
937319124 2:120950431-120950453 AGGTCAGCAGGCCTGACATAAGG + Intronic
946434922 2:219645002-219645024 AGGCCGGATGTCCTTACTGAAGG - Intergenic
948060987 2:235043214-235043236 AGAACGGAAGTCCTTCCAGAAGG + Exonic
1171849138 20:30295702-30295724 AGGTAGGAAGCCCATCCAGAGGG + Intergenic
1178434886 21:32549289-32549311 AGGTAGGAATGCCTAAAAGATGG - Intergenic
1179906089 21:44424073-44424095 AGGTGGGGAGGACTTAGAGACGG + Intronic
1181887188 22:26030651-26030673 AGGTAGCAAGGCCATAGAGAAGG - Exonic
1183890796 22:40926928-40926950 AGGTAGGGAGGAGTTACAGAAGG - Exonic
975690374 4:76957133-76957155 AGCACAGAAGGCCTTTCAGAAGG - Intronic
975802247 4:78072993-78073015 AGGAAAGAAGCCCTTACAGAAGG + Intronic
985615644 5:919110-919132 AGCTTGGAAGGCATGACAGAAGG + Intronic
989107858 5:37880347-37880369 GGGTCAGCAGGGCTTACAGATGG + Intergenic
994694746 5:103059922-103059944 AGGACAGAAGGCCTCCCAGAGGG + Intergenic
999122017 5:149217061-149217083 AGGTCGGAAGGCCTTACAGAGGG - Intronic
999709129 5:154300851-154300873 AGCTAGGAAGGCCTTCCGGAGGG + Intronic
1002870239 6:1160488-1160510 AGGTCGGGAGGCCTCAGTGATGG + Intergenic
1003542024 6:7026331-7026353 AAGTGGCAAGGCCTTCCAGAAGG - Intergenic
1005656273 6:27941462-27941484 AGGGTGGAAGGAATTACAGAAGG + Intergenic
1007317368 6:41000166-41000188 AGGTCAGGAGGCCTTCGAGAGGG + Intergenic
1007687353 6:43674843-43674865 AGGACAGAAGGCCTTAGAAATGG - Intronic
1007781309 6:44256571-44256593 AGGTCGGTAGGCCGGACAGCAGG - Intronic
1015646355 6:135393222-135393244 AGGTAGGAAGGCCTTTGAAATGG - Intronic
1017616712 6:156253773-156253795 AGGTGGGAATGCCTAGCAGATGG - Intergenic
1017971575 6:159316187-159316209 AGGTCAGGAGGCCTTACAGAGGG - Intergenic
1022085109 7:27059258-27059280 AGGTCAACAGTCCTTACAGAAGG + Intergenic
1023647090 7:42329050-42329072 AGGTAGGAAGGCTTTAAAGTAGG + Intergenic
1026493205 7:70880980-70881002 AGGACAGAAGGTCTGACAGAGGG + Intergenic
1030737642 7:113068320-113068342 AGGTGAGAAGGCATTACAGCTGG + Intergenic
1034624307 7:152480782-152480804 AAGGCGGAAGGCCTCACACATGG + Intergenic
1042034869 8:64521726-64521748 ATGACCGAAGGCCTGACAGATGG + Intergenic
1044600237 8:93996507-93996529 AGGTGGCAGGGCCTTAGAGAAGG + Intergenic
1045533209 8:103003544-103003566 AGGTGGGAAGGCCAAACCGAGGG - Intergenic
1045622405 8:103995793-103995815 AGGTAGGAAGTCCTAAGAGAAGG + Intronic
1053786860 9:41658421-41658443 AGGTAGGAAGCCCATTCAGAGGG + Intergenic
1054158203 9:61655774-61655796 AGGTAGGAAGCCCATTCAGAGGG - Intergenic
1054477976 9:65586779-65586801 AGGTAGGAAGCCCATTCAGAGGG - Intergenic
1059348718 9:113649568-113649590 AGGGCGGAAGGACTTCCACAAGG + Intergenic
1060734121 9:126055539-126055561 AGGGGGGAGGGCCTTTCAGAAGG - Intergenic
1188031272 X:25267108-25267130 AGGAAGGAAGCCCTTCCAGATGG + Intergenic
1188515889 X:30985632-30985654 CGGTTTGAAGGCCTGACAGATGG - Intergenic
1190984109 X:55485115-55485137 AGGTGGGAAGGCCTCAGATATGG + Exonic
1197632871 X:128882284-128882306 AGGTGGGAAGGCCACATAGAGGG - Intergenic
1199639646 X:149847790-149847812 AGGTGAGAAGGCCTGAGAGAAGG - Intergenic