ID: 999122941

View in Genome Browser
Species Human (GRCh38)
Location 5:149223837-149223859
Sequence CTGTAAAGAGGGATGAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999122932_999122941 -8 Left 999122932 5:149223822-149223844 CCCCCAACTTCCCATCTGTAAAG 0: 1
1: 0
2: 6
3: 77
4: 626
Right 999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG No data
999122929_999122941 5 Left 999122929 5:149223809-149223831 CCAAGCTCCCTAACCCCCAACTT 0: 1
1: 0
2: 1
3: 39
4: 451
Right 999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG No data
999122930_999122941 -2 Left 999122930 5:149223816-149223838 CCCTAACCCCCAACTTCCCATCT 0: 1
1: 0
2: 0
3: 39
4: 393
Right 999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG No data
999122933_999122941 -9 Left 999122933 5:149223823-149223845 CCCCAACTTCCCATCTGTAAAGA 0: 1
1: 0
2: 5
3: 44
4: 409
Right 999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG No data
999122931_999122941 -3 Left 999122931 5:149223817-149223839 CCTAACCCCCAACTTCCCATCTG 0: 1
1: 0
2: 4
3: 45
4: 492
Right 999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG No data
999122934_999122941 -10 Left 999122934 5:149223824-149223846 CCCAACTTCCCATCTGTAAAGAG 0: 1
1: 0
2: 2
3: 27
4: 275
Right 999122941 5:149223837-149223859 CTGTAAAGAGGGATGAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999122941 Original CRISPR CTGTAAAGAGGGATGAGGCT AGG Intronic
No off target data available for this crispr