ID: 999123656

View in Genome Browser
Species Human (GRCh38)
Location 5:149229997-149230019
Sequence CAGAGCTATCACATTTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999123656_999123661 15 Left 999123656 5:149229997-149230019 CCCCCTTAAATGTGATAGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 999123661 5:149230035-149230057 TCTTTAAGAGAAAAGAAAGCTGG 0: 1
1: 0
2: 5
3: 86
4: 856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999123656 Original CRISPR CAGAGCTATCACATTTAAGG GGG (reversed) Intronic
900840020 1:5041298-5041320 CACAGCTATCACAACTCAGGTGG - Intergenic
907374447 1:54024308-54024330 GAGACCTATCTAATTTAAGGTGG + Intergenic
912046243 1:105462082-105462104 CAGAGCACTCACATATAAGTAGG + Intergenic
912971081 1:114283803-114283825 CAGAACACTCACATTTAAAGAGG - Intergenic
918953148 1:191167188-191167210 CAGAGTTTTCACATTTCAGTAGG - Intergenic
919666386 1:200296834-200296856 CAGAGCTCACCCTTTTAAGGTGG - Intergenic
1064567906 10:16661696-16661718 CAAAGCTAGCACATTCAAAGGGG - Intronic
1070438432 10:76416378-76416400 CAGATCTATCACTTATAATGCGG + Intronic
1070659034 10:78291702-78291724 CAGAGAGGTCACATTTAATGTGG + Intergenic
1071239751 10:83692483-83692505 CAGAGCCAAGACATTCAAGGAGG - Intergenic
1078044259 11:7898988-7899010 TAGAGCTAGCACCTTTAAAGTGG - Intergenic
1085932193 11:81097168-81097190 CATAGCTATCACATTTAAACAGG + Intergenic
1091888891 12:4037069-4037091 AAGAGCTATCACATGGAAGAGGG - Intergenic
1097137474 12:56870740-56870762 GAGATCTGTCACATTCAAGGTGG - Intergenic
1098842683 12:75495333-75495355 CAGAGCTGTCACAATTAAATGGG + Exonic
1099060106 12:77897365-77897387 CAAAGCTATCGCATGAAAGGAGG - Intronic
1101850390 12:108397323-108397345 CAGAGCTGTGACATTTAAATGGG + Intergenic
1104550505 12:129752627-129752649 CAAAGCTATGCCATTTAGGGAGG + Intronic
1110256412 13:73438609-73438631 CAGAGCTACCACAGTTATGAAGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1115530156 14:34319635-34319657 CAGATCTATCTCCTTTAATGTGG + Intronic
1115574414 14:34696553-34696575 CAGAGATGTCACATATAATGGGG - Intergenic
1126712117 15:51470624-51470646 CAGAGTTAACACATGTAAAGAGG + Intronic
1127301148 15:57655103-57655125 CTGAGCTATCACAGAGAAGGGGG + Intronic
1129979042 15:79849446-79849468 CTGAGCTGTCACCTTTGAGGAGG - Intronic
1132171600 15:99662879-99662901 CATAGCAATGAGATTTAAGGTGG + Intronic
1138506326 16:57480046-57480068 CAGAGTTATCACAGTTGATGGGG - Intronic
1140765409 16:78152441-78152463 CATAGCTATCAAATTTGAAGTGG - Intronic
1153683734 18:7525275-7525297 CAAAGCTATGACAATTCAGGAGG - Intergenic
1154200946 18:12300281-12300303 CAGAGCTTTCTCATTCAAAGAGG - Intergenic
1156151409 18:34248265-34248287 CTGAGCTTTTACATTTAAAGTGG + Intergenic
1159206490 18:65259734-65259756 CAGAGCCATTACATTTAAACTGG + Intergenic
1162685668 19:12381809-12381831 CAGTGCATTCACATTTAAGCAGG - Intronic
1166431350 19:42730442-42730464 CAGAGAAATCACATCTATGGGGG - Intronic
1166451793 19:42908236-42908258 CAGAGAAATCACATCTAGGGGGG - Intronic
1166454238 19:42927102-42927124 CAGAGAAATCACATCTAGGGGGG - Intronic
1166464032 19:43016431-43016453 CAGAGAAATCACATCTAGGGGGG - Intronic
1166470186 19:43073014-43073036 CAGAGAAATCACATCTAGGGGGG - Intronic
1166490907 19:43259521-43259543 CAGAGAAATCACATATAGGGGGG - Intronic
929235928 2:39605551-39605573 CAGAGCTAGCACATGTATTGAGG - Intergenic
929898534 2:45982283-45982305 CACAGGCATCACATTAAAGGTGG - Intronic
932972812 2:76566672-76566694 CAGAGCCATCACAATAAAGATGG - Intergenic
933373752 2:81451558-81451580 CATAGCTATCATATGGAAGGGGG + Intergenic
938253957 2:129839362-129839384 CAGAGCTTTCTCATTTCACGTGG + Intergenic
938574342 2:132589964-132589986 CAGAACTAGCACATTCATGGGGG - Intronic
938615522 2:132993749-132993771 CAGAGGTGTGACATTTAAGGTGG - Intronic
939642081 2:144652829-144652851 CAGAGATATCAGATTTAATTAGG - Intergenic
939990939 2:148876103-148876125 CAGAGCTCACACTTTAAAGGGGG - Intronic
1169345936 20:4828121-4828143 CAGAAATATCTCATTAAAGGTGG + Intergenic
1180927043 22:19562631-19562653 CTGAGCTATCTCATCTCAGGAGG + Intergenic
1181502421 22:23324401-23324423 CAGAGAAATCACATCTGAGGAGG - Intergenic
1183937889 22:41274306-41274328 CAGAGCTGTCACATGTGAGGTGG - Intronic
1184025595 22:41853618-41853640 CAAAGCTTTCACTTTTAGGGAGG - Intronic
954576650 3:51680075-51680097 CAGAGCTACCCAAGTTAAGGGGG - Intronic
957751022 3:84415774-84415796 CAGTGCTAACACATTTTTGGTGG - Intergenic
963024896 3:140909959-140909981 CAGCGTTATCACAATAAAGGTGG + Intergenic
966166756 3:177028077-177028099 CAGAGCTAAGACATTTAAAAAGG + Intronic
966689599 3:182729233-182729255 AAGAGCTACCACATTGTAGGAGG + Intergenic
971046699 4:22813145-22813167 AAGACCAATCACATTTAATGTGG + Intergenic
977798456 4:101196709-101196731 CTGATCTTTCACTTTTAAGGAGG - Intronic
978905901 4:114005108-114005130 CAGAGATATAAGATATAAGGTGG - Intergenic
982392100 4:154876177-154876199 GAGAGCTATAATATTTAAAGGGG - Intergenic
983557527 4:169071688-169071710 CAGAGCTTTCACATGGAAGATGG - Intergenic
985196873 4:187440599-187440621 AAGAGCTCTCAGATGTAAGGGGG + Intergenic
990115382 5:52383492-52383514 CACAAACATCACATTTAAGGGGG - Intergenic
993341885 5:86734799-86734821 CAAAGCTATTACATTTAATGAGG - Intergenic
994965264 5:106661905-106661927 CAGAGCTTTCATATTTTGGGGGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999448396 5:151659647-151659669 CAGACCCCTCACATTTAAGTTGG + Intergenic
1000004886 5:157174545-157174567 TAGAGCTATCAATTCTAAGGGGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004882405 6:20022106-20022128 CTGAGCTATCACATTTATAGTGG + Intergenic
1006695749 6:35929218-35929240 CAGAGGTATAAAATGTAAGGGGG + Intergenic
1010950627 6:82033046-82033068 CAGAGCCATCACCTTCAAAGTGG + Intergenic
1012857648 6:104521648-104521670 TAGAAATATCCCATTTAAGGTGG + Intergenic
1014667414 6:124256524-124256546 CAGAACTATCAGATTTAGGATGG - Intronic
1015180166 6:130353219-130353241 CAGAGCTATCAAATAAAAGCTGG - Intronic
1015861134 6:137681398-137681420 CAGAGCTAAGAAATTCAAGGTGG - Intergenic
1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG + Intronic
1017502102 6:155035049-155035071 CGAAGCTTTCACAGTTAAGGAGG + Intronic
1019068219 6:169320613-169320635 CAGAGCTATCAGACCTAGGGAGG - Intergenic
1021821732 7:24505093-24505115 CAGAGCTACCTCATGCAAGGAGG + Intergenic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1027239080 7:76315538-76315560 CAGAACTGGCACATTTTAGGAGG + Intergenic
1028216457 7:88139480-88139502 CAGAGTTATCAAATTTAAATAGG - Intronic
1028654595 7:93189823-93189845 CAGAGCTGGCACATTCAAGTTGG + Intronic
1030975341 7:116115081-116115103 TAGAGGTATCACATGTAACGTGG + Intronic
1032207316 7:129878930-129878952 CAGATCTATCTGATTGAAGGTGG - Intronic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1037101987 8:15058107-15058129 TGGAGCTATCACATTTTAGTAGG + Intronic
1039081418 8:33737644-33737666 CAGTGCTCTCACCTTGAAGGTGG + Intergenic
1043033116 8:75164170-75164192 CTGAGCTATCACCTTTGAGATGG - Intergenic
1048044313 8:130758966-130758988 CTGAGCTGTCACATTAGAGGAGG - Intergenic
1052569594 9:30202247-30202269 AAGTGCTATCTCATTTAAGGCGG - Intergenic
1056235669 9:84591518-84591540 CAGAGTTATCAGATTTGATGAGG + Intergenic
1056469207 9:86888679-86888701 AATAGCAATCAAATTTAAGGTGG + Intergenic
1059326581 9:113507473-113507495 CAGAGCTGTCACATACCAGGTGG - Exonic
1061758513 9:132833209-132833231 CAGAGCTCTTGCATTTAAAGGGG + Intronic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1189993772 X:46619658-46619680 CAGAGCAATTACATTTGGGGAGG + Intronic
1192736689 X:73855921-73855943 CAGGGCTATGCCATTTAAAGAGG + Intergenic
1194668704 X:96704503-96704525 CAGCACTATCACATTTATGAAGG - Intronic
1194965823 X:100287757-100287779 AAGAGGTATAACATTTAAAGGGG + Intergenic
1194966241 X:100291694-100291716 CAGAGAAAACACATTTAAAGGGG + Exonic
1197261736 X:124326926-124326948 CTGTGCTATCATATTTAAGATGG + Intronic
1197331435 X:125158020-125158042 CAGAGACATCAAATTTATGGCGG + Intergenic