ID: 999123807

View in Genome Browser
Species Human (GRCh38)
Location 5:149231207-149231229
Sequence CGGCTGTGCTTTGTTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999123807_999123815 9 Left 999123807 5:149231207-149231229 CCTGCAGTAACAAAGCACAGCCG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 999123815 5:149231239-149231261 GGTACGCGCTGGGCCAGCTGAGG No data
999123807_999123811 -1 Left 999123807 5:149231207-149231229 CCTGCAGTAACAAAGCACAGCCG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 999123811 5:149231229-149231251 GACATCCCCAGGTACGCGCTGGG 0: 1
1: 0
2: 1
3: 0
4: 47
999123807_999123810 -2 Left 999123807 5:149231207-149231229 CCTGCAGTAACAAAGCACAGCCG 0: 1
1: 0
2: 0
3: 7
4: 107
Right 999123810 5:149231228-149231250 CGACATCCCCAGGTACGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999123807 Original CRISPR CGGCTGTGCTTTGTTACTGC AGG (reversed) Intronic