ID: 999128488

View in Genome Browser
Species Human (GRCh38)
Location 5:149264659-149264681
Sequence CTGTCTCCATGGCTTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999128488_999128496 20 Left 999128488 5:149264659-149264681 CCATCCACAAGCCATGGAGACAG No data
Right 999128496 5:149264702-149264724 TGCTGGCAGAAATTCTGTTGTGG No data
999128488_999128494 3 Left 999128488 5:149264659-149264681 CCATCCACAAGCCATGGAGACAG No data
Right 999128494 5:149264685-149264707 TCAGAGGAAACCAGCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999128488 Original CRISPR CTGTCTCCATGGCTTGTGGA TGG (reversed) Intergenic
No off target data available for this crispr