ID: 999128757

View in Genome Browser
Species Human (GRCh38)
Location 5:149266587-149266609
Sequence CTGCAGCCACAGATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999128749_999128757 22 Left 999128749 5:149266542-149266564 CCAGGTTATAAAATCCACTTTGG No data
Right 999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG No data
999128751_999128757 8 Left 999128751 5:149266556-149266578 CCACTTTGGACCTCTGCAACCTG No data
Right 999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG No data
999128753_999128757 -2 Left 999128753 5:149266566-149266588 CCTCTGCAACCTGGCACCAGCCT No data
Right 999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999128757 Original CRISPR CTGCAGCCACAGATGAAGCT AGG Intergenic
No off target data available for this crispr