ID: 999130476

View in Genome Browser
Species Human (GRCh38)
Location 5:149279146-149279168
Sequence CTAAAGTTGAAGTGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999130468_999130476 23 Left 999130468 5:149279100-149279122 CCACATGAGAAGTTATTGAAGGA 0: 1
1: 0
2: 3
3: 18
4: 191
Right 999130476 5:149279146-149279168 CTAAAGTTGAAGTGGGGACATGG 0: 1
1: 1
2: 1
3: 13
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999130476 Original CRISPR CTAAAGTTGAAGTGGGGACA TGG Intronic
901155686 1:7136425-7136447 CTAAGGTTGAAGGAGGGAGAGGG - Intronic
903346158 1:22685581-22685603 CTGAAGGGGAACTGGGGACAGGG - Intergenic
904153343 1:28461662-28461684 CTGAAGTTGAGGTGGGAACATGG + Intronic
905267995 1:36768325-36768347 ATAAAGGTGAAGAGGGGGCAGGG + Intergenic
905916140 1:41685616-41685638 CTACAGTTGAGGTGGGGACCTGG - Intronic
906823081 1:48949669-48949691 CCAAGGTTGAAGTGGGAAGAGGG - Intronic
909377614 1:74957895-74957917 CTTAAGTTTAGGTGGGAACATGG + Intergenic
910341864 1:86197642-86197664 ATAAAGTTGAGATGAGGACAAGG - Intergenic
911667214 1:100566876-100566898 CTAAAGTTAAAATGGGTAAAAGG - Intergenic
912207229 1:107521969-107521991 CTCAAGTTGAACTGAAGACAAGG - Intergenic
914396500 1:147274374-147274396 ATCAAGTTGAAGTTGGAACAAGG - Intronic
914452202 1:147802594-147802616 GTAATGTGGCAGTGGGGACAAGG + Intergenic
914765516 1:150634512-150634534 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
914990481 1:152495811-152495833 CCAAAGTTGAGTTGGGGGCAAGG + Intergenic
915402163 1:155630948-155630970 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
915460944 1:156070329-156070351 CTGGGGCTGAAGTGGGGACAAGG - Exonic
915892362 1:159783746-159783768 ATAAAGTTAAACTGGGGAGAGGG - Intergenic
916009936 1:160695717-160695739 CAAAAGTTGGAGTGGGGCTAAGG - Intronic
917123932 1:171669258-171669280 TTAAAGTTTTAGTAGGGACAAGG + Intergenic
922413124 1:225394957-225394979 ACAAAGTTGAAGTAGGGAAAGGG - Intronic
924021075 1:239783846-239783868 GTAGAGTGGAAGTGGGGAAAGGG - Intronic
1063530712 10:6828751-6828773 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
1064010244 10:11729868-11729890 CCAAAATTGAAGTGGGCACCAGG - Intergenic
1064875073 10:19984389-19984411 GTAAAGTCAAAGTGAGGACATGG + Intronic
1064875239 10:19986684-19986706 GTAAAGTTAAAGTGAGAACACGG + Intronic
1065205237 10:23351024-23351046 CTACAGTTAAAGTGGGGAGTTGG + Intergenic
1065550305 10:26862981-26863003 CTAATGTTGGAGTTGGGACCTGG + Intergenic
1068990297 10:63143232-63143254 CAAAAATAGAAGTGGGGAAAAGG + Intronic
1070447723 10:76523812-76523834 CAAAAGTTAAAGTTGGGAAATGG - Intronic
1071334932 10:84592870-84592892 CTAAAGTTGGAGTGCTGGCAGGG - Intergenic
1072947558 10:99824033-99824055 CAAAAGTTGGAGTGGGGCTAAGG + Intronic
1073828527 10:107355081-107355103 CTGAAGTTTGAATGGGGACAGGG - Intergenic
1073895032 10:108145707-108145729 CTAAACTGGGAGTGGGGACTGGG - Intergenic
1076564281 10:131387386-131387408 CTGAAGTGGGAGTGGGCACAGGG - Intergenic
1079111211 11:17606197-17606219 GGAAGGGTGAAGTGGGGACAGGG - Intronic
1080881750 11:36327848-36327870 GAAAACTTGAAGTTGGGACAGGG - Intronic
1083002990 11:59314056-59314078 GTAAAGTGGAATTGGGGGCATGG - Intergenic
1083394179 11:62377919-62377941 CAAAAGTTGGAGTGGGGCTAAGG + Intronic
1087724270 11:101699938-101699960 CAAAAGTTGGAGTGGGGCTAAGG - Intronic
1088935689 11:114397914-114397936 TTAAAGTTGAAATGGGGAGTTGG - Intronic
1090123400 11:124057201-124057223 CTAAGGGTGATGTGGGAACAGGG - Intergenic
1092601511 12:10071347-10071369 CTAATGTTTCAGGGGGGACATGG + Exonic
1093503049 12:19834339-19834361 CTAAAGTTAAAGAGGACACAAGG - Intergenic
1094777858 12:33752779-33752801 CCAAATGGGAAGTGGGGACAAGG - Intergenic
1095344364 12:41132335-41132357 CTAAAGTTGGAATGAGCACAGGG + Intergenic
1102203448 12:111074418-111074440 CTAAAGTGGAAGATGGGGCAGGG + Intronic
1102721918 12:115023841-115023863 TTAAGGTTGCAGTGGGGAAAAGG + Intergenic
1103834098 12:123805244-123805266 AGACAGTTGAAGTGGGGAGAGGG - Intronic
1107623027 13:42253094-42253116 CTAAAGTTGAAGGTGTGGCATGG + Intronic
1108311683 13:49198486-49198508 CTTAAGCTGAAATGGGGAGAAGG + Exonic
1109636890 13:65131882-65131904 CCAAAATCGAAGTGTGGACAGGG - Intergenic
1111571417 13:90091907-90091929 CCAAAGTTGAAGGAGGGTCATGG - Intergenic
1112256912 13:97842385-97842407 ATATAATTGTAGTGGGGACAGGG - Intergenic
1112265078 13:97916194-97916216 CTAAGGTTGGAGTGAGGAAAAGG + Intergenic
1114007863 14:18333267-18333289 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1114400190 14:22402946-22402968 CAGGAGTTGAAGTGGGGGCAAGG + Intergenic
1116694848 14:48160040-48160062 GAAAAGTTGAAGTAGGGAAATGG + Intergenic
1118179157 14:63473943-63473965 TTAAAGTTGGAGTGAGCACATGG + Intronic
1120263819 14:82224017-82224039 CTAAAGTTAAAGAAGGGTCAGGG - Intergenic
1124873788 15:33571150-33571172 CTAAGGTGGGGGTGGGGACAGGG + Intronic
1125437455 15:39662143-39662165 CTATAGTTGGAGTGGGGGAAAGG + Intronic
1125818675 15:42608972-42608994 CTAAGGCTGAAGCTGGGACATGG - Intronic
1127459077 15:59181477-59181499 TAAAAGTTGTAGTGGGGAGATGG + Intronic
1127684310 15:61327031-61327053 CTAAAGGTGAAGTGGAAACTGGG + Intergenic
1131605774 15:93901059-93901081 CCAAAATTGAAGTGGGCACAGGG + Intergenic
1140536436 16:75714206-75714228 TTTAAGTTGAAGAGTGGACAAGG - Intronic
1140613953 16:76636879-76636901 CTAAAATTGAGGTGTGGCCAGGG + Intergenic
1141003115 16:80326599-80326621 CCAAAGGATAAGTGGGGACATGG - Intergenic
1141243633 16:82286360-82286382 CTAATGTTGATGTGGGAAAATGG - Intergenic
1146072014 17:29691244-29691266 CTAAAGCTGAAGTGTTGATAAGG - Intronic
1146258264 17:31404309-31404331 GAAAAGTGGAAGTGGGGACGGGG - Intronic
1146954924 17:36931848-36931870 CAAAAGTGGAGGTGGGGGCAGGG + Intergenic
1150307091 17:64094788-64094810 GAAAAAATGAAGTGGGGACATGG - Intronic
1152307342 17:79529025-79529047 CTCAGGTAGAGGTGGGGACATGG + Intergenic
1152308971 17:79537752-79537774 CTCAATTTGAGGTGGGGAGATGG - Intergenic
1153737649 18:8088518-8088540 CTTGAGTTGAAGTTGGGAGATGG - Intronic
1155304905 18:24469568-24469590 ATAAAGTTGAAATAAGGACAAGG + Intronic
1158485242 18:57860374-57860396 ATAAAGTTTAAGTGTGGCCATGG - Intergenic
1159986141 18:74843457-74843479 GTAAAGATGAAGTGTGGATAAGG - Intronic
1165606627 19:37111185-37111207 CAAAAGTTGGAGTGGGGCTAAGG + Intronic
1167916864 19:52747771-52747793 CAAAAGTTGGAGTGGGGTTAAGG + Intergenic
925864772 2:8217827-8217849 TTAAAATAGAAGTGGGGGCAGGG - Intergenic
926865418 2:17351886-17351908 GTAAAATTGAAGTGAGGAAAAGG + Intergenic
927049463 2:19312534-19312556 GCAAAGGTGAAGTGGGAACAAGG + Intergenic
928598141 2:32876361-32876383 CTAGAGGTGAAGTGGGTGCAGGG + Intergenic
928938239 2:36702648-36702670 CCAGAGTTGAAGTGGGTACAGGG + Intronic
930466776 2:51763102-51763124 CAAAAGTTTAAGTGGTGACTAGG + Intergenic
931509876 2:62979858-62979880 CTAAGCTTGATGTTGGGACAAGG + Intronic
932756737 2:74414799-74414821 CTAAATTTAAAGTGGGGAACAGG + Exonic
933128809 2:78646775-78646797 CTAAAATTGAAGTGAGTACAGGG + Intergenic
933722735 2:85408796-85408818 CTAAAGTTGAAGAGGGGAGCTGG + Intronic
933981287 2:87552981-87553003 CCATGGTGGAAGTGGGGACATGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
936312543 2:111397818-111397840 CCATGGTGGAAGTGGGGACATGG - Intergenic
938247744 2:129792103-129792125 CTAAGGTGGAAGTGGGACCATGG + Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
945463548 2:210140318-210140340 CTTAAGTTGATGTGGGAATAAGG + Intronic
945741186 2:213664009-213664031 CTAAAATTGAAGTGTTGTCAGGG + Intronic
945783221 2:214203285-214203307 TTTAAGTTGAAGGGGGGAAATGG + Intronic
946654529 2:221931848-221931870 CTAGAGTTGCAGTGTGGACAAGG + Intergenic
946691437 2:222311658-222311680 CGAAAGTTGGAGGGGGGACTTGG - Intergenic
1169451364 20:5714637-5714659 CTACAGTGGGAGTGGGGGCAGGG - Intergenic
1171503136 20:25610238-25610260 AACAAGTTGGAGTGGGGACAGGG - Intergenic
1172337620 20:34130507-34130529 CAAAAGTTGGAGTGGGACCAAGG - Intergenic
1172386676 20:34538884-34538906 CCACAGGTGGAGTGGGGACAGGG - Intronic
1173172917 20:40741988-40742010 CTACGGGAGAAGTGGGGACAGGG - Intergenic
1173793482 20:45842772-45842794 ATAACCTTGAAGTGAGGACATGG - Intronic
1173903472 20:46608014-46608036 CTAGGGTTGAAATGGGGAAAAGG + Intronic
1175622507 20:60460980-60461002 CCAAAGTTGGAGTTGGGACCTGG + Intergenic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1177248680 21:18564908-18564930 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
1177421223 21:20860495-20860517 CTGAAGATGAAGTGGGCACTTGG - Intergenic
1178242366 21:30917562-30917584 AAAAGGTTGTAGTGGGGACATGG + Intergenic
1180432369 22:15264077-15264099 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1180514933 22:16132015-16132037 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG + Exonic
951426441 3:22551814-22551836 ATAAAGTACAAGTGAGGACATGG + Intergenic
952107317 3:30085280-30085302 CTAAATAGGAAGTGGGGAAAAGG + Intergenic
953035270 3:39205726-39205748 CTAAACTTGAAGCTGTGACAAGG + Intergenic
954188455 3:48938888-48938910 CTAAAGACCCAGTGGGGACAGGG - Intronic
954447166 3:50553000-50553022 CTCAAGTCCAAGTGGGGACTAGG + Intergenic
960027792 3:113028547-113028569 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
961068464 3:123897467-123897489 CTGAAGTTGAAGTGGGTGCTGGG + Intronic
962141373 3:132794033-132794055 CCAATGTTGGAGTTGGGACATGG - Intergenic
965749017 3:171957413-171957435 GTAAAGATGAGGTGAGGACACGG - Intergenic
966730178 3:183144438-183144460 CTGAAGTGGAAGTGGGGAAGGGG + Intronic
967026224 3:185566830-185566852 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
967154554 3:186680628-186680650 CCCAAGTTGAAGTGCGGTCATGG - Intergenic
970020957 4:11568078-11568100 CCAATGTCGGAGTGGGGACATGG - Intergenic
972432210 4:38993926-38993948 CTGAAGTTAAAGTGCTGACAAGG + Exonic
972944153 4:44232926-44232948 CTAAAGTTGGAGTGGGAAAGTGG + Intronic
975618319 4:76269954-76269976 CAAAAGATGGGGTGGGGACATGG - Intronic
975618669 4:76273974-76273996 CAAAAGGTGAAGTTGAGACATGG - Intronic
977511123 4:97964216-97964238 CTAAAGTCTTACTGGGGACAAGG + Intronic
979236046 4:118401427-118401449 CTAAAATTGAGGTGTGAACAGGG - Intergenic
980175629 4:129340762-129340784 CTAGGGTTGATTTGGGGACATGG + Intergenic
980401861 4:132298328-132298350 CTAGAGGGGAGGTGGGGACAAGG + Intergenic
981898077 4:149828294-149828316 CTAGAGTTCAAGGGGGGAAATGG - Intergenic
982741437 4:159061299-159061321 CTGAAGGTGATGAGGGGACAGGG - Intergenic
982988054 4:162234993-162235015 CTAAACTTGAGGAGGGGAGAGGG - Intergenic
984973969 4:185214070-185214092 CTAAAGGGGAAGTGGGGAACTGG - Intronic
988380373 5:30491215-30491237 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
988790735 5:34605044-34605066 CTAAACTTGGGGTGGGGCCATGG - Intergenic
989836841 5:46004318-46004340 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
991641429 5:68758231-68758253 CTAACAGTGAAGTGGGAACAAGG - Intergenic
991661823 5:68958423-68958445 CCAAACTTGAAATGGGGAGAGGG + Intergenic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
993932443 5:93956300-93956322 CTTAAGTTGAAAGGAGGACATGG - Intronic
995399009 5:111719581-111719603 CTTATGGTGAAGTGGGGAGAGGG - Intronic
997039056 5:130230019-130230041 CTAAAGATGAAGTAGGTAAATGG + Intergenic
999130476 5:149279146-149279168 CTAAAGTTGAAGTGGGGACATGG + Intronic
999624396 5:153505023-153505045 CTATACCTGAAGAGGGGACAGGG + Intronic
1001441061 5:171743394-171743416 CTATAGCTGAAGTGGGAAGATGG - Intergenic
1002178569 5:177417276-177417298 CTAAAGAGGAAGTGGGGGCCGGG - Intronic
1003879745 6:10469153-10469175 CTAAACTTGAAGTGTGGGCTGGG + Intergenic
1004912869 6:20303581-20303603 CAAAGGTGGAAGTGGGGAAAAGG - Intergenic
1005591012 6:27327331-27327353 CAAAAGGTGAAGCAGGGACACGG - Intergenic
1005730093 6:28688361-28688383 CAAAAGTTGGAGTGGGGCTAAGG - Intergenic
1005805585 6:29471515-29471537 CTAAAATTGAACTGGAGAAAGGG - Intergenic
1006045355 6:31290943-31290965 CTAAAGTTGAATGGAGGCCATGG + Intronic
1006709666 6:36056855-36056877 CTTAAGTAGAAGTGGGTATAAGG + Intronic
1007646065 6:43382153-43382175 CTAAAATTAAGGTGTGGACAGGG - Intergenic
1009836454 6:69007448-69007470 CTAGAGTTGAAGAGGGGGCTGGG - Intronic
1009994833 6:70886558-70886580 CTGAAGGGGAAGTGGGGAGACGG - Intronic
1010591847 6:77721482-77721504 CAAAAGTTGGAGTGGGGCTAAGG + Intronic
1012597894 6:101061482-101061504 GTAAAGTTGGAGGGGGCACAAGG + Intergenic
1012869716 6:104658820-104658842 CCAAAGTAGAAGAGGGGAAATGG + Intergenic
1015408304 6:132862574-132862596 CTAAATTAGAAGTAGGAACAAGG - Intergenic
1016063914 6:139659443-139659465 CTAGAGTTGAAGTGCAGACGAGG + Intergenic
1016308163 6:142705112-142705134 CCAAATTTGAGGTGGGGGCATGG - Intergenic
1017346711 6:153391438-153391460 CAACAGTTGCAGTGGGAACAAGG + Intergenic
1019662505 7:2232645-2232667 CCAAAGGGGGAGTGGGGACAGGG + Intronic
1019976524 7:4587000-4587022 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
1019977460 7:4595504-4595526 CAAAAGTTGGAGTGGGGCTAAGG + Intergenic
1023000539 7:35802623-35802645 CTAAAGTTTATGTGCAGACATGG + Intronic
1023553909 7:41400033-41400055 TTTAAGTTGAAGTGGGGCTAGGG - Intergenic
1023924000 7:44651872-44651894 CTAAAATTTAAGTAGAGACAGGG + Intronic
1023943769 7:44787223-44787245 CTAAAGTTGAAGTTGGGGGCGGG - Intergenic
1023981231 7:45071623-45071645 CTAAAGTTGAGGTGTCCACAGGG + Intronic
1024824777 7:53379040-53379062 CCAAGGCTGACGTGGGGACATGG - Intergenic
1028880745 7:95877042-95877064 TTAAAGCTGAATTGGGGGCAAGG - Intronic
1029236972 7:99128607-99128629 CTAAAATTTAAATGTGGACAGGG - Intronic
1029248467 7:99219255-99219277 CAAAAGGTGAAGTGGGGTGAGGG + Intergenic
1031035107 7:116780475-116780497 CAAAAGTTGAAGTGGGAAAGTGG - Intronic
1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG + Intronic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1036292072 8:7502449-7502471 CAAAAGTTGGAGTGGGGCTAAGG + Intronic
1036539725 8:9694205-9694227 CTAAAGGTCAAGAGAGGACAAGG - Intronic
1036659246 8:10697477-10697499 TTAAAAATGCAGTGGGGACATGG + Intronic
1037895301 8:22648344-22648366 CTGAAGGTGACGTGGGGACCTGG - Intronic
1038201704 8:25418960-25418982 CAGAAGTTGAGGTGGGGCCACGG - Intergenic
1038966581 8:32579842-32579864 CTAAAATTGAAGTGTTGGCAGGG + Intronic
1041013995 8:53572442-53572464 CTAAAGGAGAAGAGGTGACAAGG - Intergenic
1041172751 8:55161623-55161645 CTAATGTTGCAGTGGGGATTGGG + Exonic
1041487135 8:58391907-58391929 CTAAAGCTGAGGTGTGGGCAGGG - Intergenic
1041976880 8:63809666-63809688 CTAAAGTAGAAGTGCTGACAGGG + Intergenic
1045000616 8:97875008-97875030 CAAAAGTAGAAGAGGGGCCAGGG - Intronic
1048392410 8:133980208-133980230 TTAAATTTGAAGTGGGGGCAGGG - Intergenic
1049826922 8:144674890-144674912 CCAAAATTGACGTGGGGACCAGG + Intergenic
1052432358 9:28383085-28383107 AAAAATTTTAAGTGGGGACATGG - Intronic
1052504182 9:29330951-29330973 CCAAATTTGAAGTGGTGCCATGG - Intergenic
1055253719 9:74339859-74339881 TTAATTTTGAAGTGGGGAGAGGG + Intergenic
1055673596 9:78632243-78632265 CAAAAGTTCAAGTGGGCCCATGG + Intergenic
1056770175 9:89472723-89472745 CTTAAGTTGAATGGGGGAAAAGG - Intronic
1057680633 9:97179716-97179738 CTAAAGTTGAATTGTAGAGATGG - Intergenic
1058241560 9:102568805-102568827 CTTGAGTTGAATTGGAGACAAGG + Intergenic
1060063955 9:120486211-120486233 CTAGAGCTGGAGTGGGGACCTGG - Intronic
1061266397 9:129507772-129507794 CTAAAACTGAAGAGTGGACAGGG - Intergenic
1062487021 9:136783528-136783550 CAAAAGTTGGAGTGGAGCCAAGG + Intergenic
1185944882 X:4364360-4364382 CTAATTTAGGAGTGGGGACAAGG + Intergenic
1185966280 X:4607626-4607648 CCAAAGTTGAGGGAGGGACATGG + Intergenic
1186290772 X:8096106-8096128 CTAAACTTGGTGTGGGGAAATGG - Intergenic
1187663846 X:21581583-21581605 TTAAAGTGGAAGTGGTGAAAAGG + Intronic
1190869499 X:54413347-54413369 CAAAGGTGGAAGTGGGAACAGGG + Intergenic
1192243944 X:69358061-69358083 GGAAAGATGAAGGGGGGACAGGG - Intergenic
1195613864 X:106897359-106897381 CTGGAGTTGAAGTTGGCACAAGG + Intronic
1195834370 X:109096130-109096152 CAACAGTGGCAGTGGGGACAAGG + Intergenic
1196798745 X:119523524-119523546 CTAAAAGTTTAGTGGGGACAGGG - Intergenic
1197620285 X:128740276-128740298 CTAAAGTCGAAGTGGGGTAGAGG + Intergenic
1198096138 X:133381591-133381613 CTGAAGTTTAACTGTGGACAGGG - Intronic
1198278348 X:135118280-135118302 TTAAAGCTGAAGAGGGGACAGGG - Intergenic
1198292614 X:135254236-135254258 TTAAAGCTGAAGAGGGGACAGGG + Intronic
1198298517 X:135310432-135310454 CTAAAGCTGAAGAGGGGACAGGG + Intronic
1198300647 X:135331491-135331513 CTCAAGCTGAAGAGGGGACAGGG + Intronic
1198307594 X:135398408-135398430 CTAAAGGTGAAGTGGGGACAGGG + Intergenic
1199242436 X:145563373-145563395 CAAAAGTTTCAGTGGGGGCAGGG + Intergenic
1199259705 X:145757782-145757804 CTAGTGTTGAAGTGGGGAAATGG + Intergenic