ID: 999133086

View in Genome Browser
Species Human (GRCh38)
Location 5:149299422-149299444
Sequence GGCCCCCCACCACCTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999133086 Original CRISPR GGCCCCCCACCACCTAGAGT TGG (reversed) Intronic
900406882 1:2496679-2496701 GGCCACCCACGACATAGAGATGG + Exonic
900525102 1:3124733-3124755 AGCCCCCCTCCACCTAAGGTGGG + Intronic
902362398 1:15949345-15949367 GCCCCAACACCACCCAGAGTGGG + Intronic
902396097 1:16133140-16133162 GGCCCCTCTCCACCCAGTGTGGG + Intronic
902628929 1:17693329-17693351 GTGCCCCCAGCACCTAGTGTGGG + Intronic
902720863 1:18303079-18303101 GGCCCCCAACCACCAAGGATGGG + Intronic
903947709 1:26974002-26974024 GTCCCCCCACCACCCAGGGGTGG - Intergenic
905680908 1:39869955-39869977 GGCCCCCCACCTCCCAGACGGGG - Intronic
907284423 1:53370866-53370888 GGCCTCCCAACACCTGGCGTGGG - Intergenic
914339135 1:146743344-146743366 GCCCTCCAACCACCTAGAGAGGG - Intergenic
916115449 1:161481552-161481574 GGACCCCCACCAGCGAGACTGGG - Intergenic
917723506 1:177808780-177808802 GTCCTCCCACCTCCTAGGGTTGG + Intergenic
917971534 1:180211241-180211263 CGCACCCCACCACCGAGAGGAGG - Intergenic
919362160 1:196609019-196609041 GGCCCCCCTCCTCCCAGAGAAGG - Exonic
920065498 1:203266716-203266738 GGCCCCCCACCCCCCAGACGGGG + Intronic
920161687 1:204003339-204003361 TGCCCCCCACCTCCGAAAGTGGG - Intergenic
924943729 1:248830384-248830406 GGCCCCCCACCTCCCAGACGGGG - Intergenic
1063822656 10:9855588-9855610 GGCCCCCCACCTCCCAGAAGGGG + Intergenic
1071476808 10:86032270-86032292 GGCCCCCCACCTCCCAGACGGGG - Intronic
1071509173 10:86250586-86250608 TGCCCCCCACCTCCCAGACTGGG - Intronic
1071509257 10:86250788-86250810 GGCCCCCCACCTCCCAGACGGGG - Intronic
1075158839 10:120004905-120004927 TGCCCCCCACCAGCTCCAGTGGG - Intergenic
1075892930 10:125970212-125970234 GGCCCCCCACCCCCCAGAGGGGG + Intronic
1076283720 10:129273878-129273900 GGCCCGCCAGCACCCAGAATGGG - Intergenic
1077839735 11:5961158-5961180 GGCCCCCCACCTCCCAGACTGGG - Intergenic
1080214277 11:29823368-29823390 GACCCCCCAACACCTAGACCAGG + Intergenic
1080678426 11:34449873-34449895 GGCCTCCCACCACCTTGAACTGG - Intronic
1084227613 11:67727028-67727050 GGCCTCCACCCACCCAGAGTGGG + Intergenic
1084674923 11:70628728-70628750 AGCCCCTCACCACCCAGAGGCGG - Intronic
1084844704 11:71889844-71889866 GGCCTCCTCCCACCCAGAGTAGG - Intronic
1084952732 11:72675578-72675600 GCCCCCCCACCACCCAAACTAGG - Intergenic
1088450170 11:109973220-109973242 CTCCACCCACCACCTAGAATAGG + Intergenic
1089192074 11:116660543-116660565 GTCCCACCACCACCTACAGTGGG + Intergenic
1091207194 11:133829933-133829955 AGCCCCTCACCACCCAGAGTTGG - Intergenic
1092038491 12:5362484-5362506 GACCCCCCATCACCTAGAGAGGG - Intergenic
1098214250 12:68199176-68199198 GGGCCCCCAGCACCTAGAGCAGG - Intergenic
1102346009 12:112161884-112161906 GGCCTCCCTCCACATAGAGGTGG - Exonic
1103151757 12:118646413-118646435 CACAACCCACCACCTAGAGTTGG + Intergenic
1104152219 12:126094779-126094801 GGACCCACACCTCCTAGAGAGGG - Intergenic
1117042351 14:51778608-51778630 GACCATCCACCACCTAGAGCAGG + Intergenic
1117458333 14:55920045-55920067 GCCCCCCCACCCCCTAGACATGG + Intergenic
1118745912 14:68773112-68773134 GGGCACCCACCACCCAGAGTCGG + Intergenic
1119619146 14:76118555-76118577 GGACCCCCACCACCCAGGTTTGG - Intergenic
1119674859 14:76546158-76546180 GGCCACCTCCCACATAGAGTAGG + Intergenic
1120398313 14:83996074-83996096 GGCCGCCCAGCACCCAGTGTTGG - Intergenic
1122037650 14:98960462-98960484 AGCGCCCCACCACCTGGAGCAGG + Intergenic
1123918831 15:25056550-25056572 GGCCCCCAACATCCTGGAGTTGG + Intergenic
1125512739 15:40301710-40301732 GCGCCCCCACCACCCAGGGTAGG + Intronic
1125748943 15:42015592-42015614 GGCCCCCCAGCATCTAGCATAGG - Intronic
1126099501 15:45111164-45111186 GGCCCGCCAGCACCCAGACTGGG - Exonic
1126104026 15:45135873-45135895 GGCCCGCCAGCACCCAGACTGGG + Exonic
1126816463 15:52459755-52459777 GGCCCCCCACCTCCCAGACGGGG + Intronic
1127880864 15:63157546-63157568 GTCCCCCTACCACCGAGAGGAGG - Exonic
1128932454 15:71717752-71717774 GACCCCCCACCACCATGAGAGGG + Intronic
1129033912 15:72638539-72638561 GTACCCCCAGCACTTAGAGTGGG + Intergenic
1129215970 15:74098677-74098699 GTACCCCCAGCACTTAGAGTGGG - Intergenic
1129408823 15:75337775-75337797 GTACCCCCAGCACTTAGAGTGGG + Intronic
1131479655 15:92769910-92769932 GTCCCACTACCACCAAGAGTAGG - Intronic
1133074708 16:3271390-3271412 GGCCCCCCACCACCCGGACGGGG + Intronic
1134119194 16:11571692-11571714 GGCCCACTCCCACCTAGAGATGG - Intronic
1135319542 16:21483081-21483103 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1135372379 16:21914569-21914591 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1135439407 16:22456139-22456161 TTCCCCCCGCCCCCTAGAGTGGG + Intergenic
1136329774 16:29564803-29564825 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1136444401 16:30304507-30304529 TTCCCCCCGCCCCCTAGAGTGGG - Intergenic
1137438995 16:48483022-48483044 GGCCCCCCACCTCCCAGATGGGG + Intergenic
1138815569 16:60199407-60199429 GGCCCCCCACCTCCTGCTGTTGG - Intergenic
1139995143 16:70974008-70974030 GCCCTCCAACCACCTAGAGAGGG + Exonic
1143372657 17:6449900-6449922 GGCCCCTCAACACATAGAGCTGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1144682435 17:17204841-17204863 TGCCCCACACCACCCAGAGCAGG + Intronic
1147020302 17:37526284-37526306 AGCCCCCCACCAACTTGAGATGG + Intronic
1147607943 17:41784961-41784983 CGCCCCCCCCCACCCAGAATTGG - Intronic
1149526980 17:57364194-57364216 GGCCCCTCACCACCTACATGAGG - Intronic
1149961900 17:61118614-61118636 GCACCCCCACCACCCACAGTGGG - Intronic
1150894566 17:69196109-69196131 GGCCCCCCACCTCCCAGACGGGG + Intronic
1150894608 17:69196196-69196218 TGCCCCCCACCTCCTGGAGGGGG + Intronic
1152368638 17:79871530-79871552 GTCCCACCACCAGCTGGAGTGGG + Intergenic
1152388664 17:79990289-79990311 GGGCTCCCACCACCTGGAGCCGG - Intronic
1153020484 18:624148-624170 GGCTCCTCACCACCCAGAGCAGG + Intronic
1157108183 18:44794351-44794373 TGCACCCCACCACCAAGAGGTGG + Intronic
1158618441 18:59009037-59009059 GGCGTCCCATCATCTAGAGTAGG - Intergenic
1162232427 19:9278756-9278778 GGCCGGCCACCACGTAGAGCAGG + Intergenic
1162683319 19:12362654-12362676 GGCCCCCCACCTCCCAGACGGGG - Intronic
1162695167 19:12468100-12468122 CGCCCCCCACCTCCTGGACTGGG - Intronic
1164217191 19:23160833-23160855 GGCCCCCCACCTCCCAGACGGGG + Intergenic
1166101771 19:40575791-40575813 GGACCCCCAGCACCTGGGGTGGG - Exonic
1167209381 19:48123513-48123535 GGCCCGACACCATTTAGAGTCGG + Intronic
1168378308 19:55899212-55899234 TACCCCCCAGCACCCAGAGTTGG + Intronic
925239991 2:2316646-2316668 GGCAACCCACCACCTACAGCTGG + Intronic
929541929 2:42829312-42829334 TGTCCCCCACCACCTGGAGGAGG + Intergenic
930970152 2:57385597-57385619 GGCCCCACAGCAGCTAGAGGTGG - Intergenic
932350038 2:71024231-71024253 GGCCTCCACCCACCCAGAGTAGG - Intergenic
933782851 2:85813952-85813974 GTCTCCCCACCCCTTAGAGTGGG + Intergenic
934128777 2:88926258-88926280 CGCCCCCCACCTCCCAGACTGGG - Intergenic
937095494 2:119232791-119232813 GGCCCCCCACCACCTACCCCTGG + Intronic
938253405 2:129833634-129833656 TGCCCCCCACCTCCTGGACTGGG - Intergenic
938482590 2:131673808-131673830 GGCCCCCCAGCAGCCAGAGGGGG - Intergenic
940817220 2:158310510-158310532 GGCCCCCCACCCCCCAGACGGGG + Intronic
940872284 2:158870002-158870024 GGCCTCCACCCACCCAGAGTAGG - Intergenic
940874494 2:158886002-158886024 GGCCTCCACCCACCCAGAGTAGG - Intergenic
947592772 2:231395044-231395066 GGCTCCCCACCACCAAGGGAAGG - Intergenic
948730034 2:239957022-239957044 AGCCCTCCAACACCTACAGTGGG + Intronic
1174524814 20:51162457-51162479 GGCCCCCCACCAGCTAGCTGTGG - Intergenic
1179628677 21:42663633-42663655 GGCACCCCGCCCCCAAGAGTCGG - Intronic
1180099033 21:45575792-45575814 GGGCACCCACCACCCAGAGCAGG + Intergenic
1181812942 22:25415353-25415375 TGCCCCCCACGACCTGGTGTTGG + Intergenic
1183942227 22:41302236-41302258 GGCCCCGCAGCACCCGGAGTTGG + Intronic
1184035955 22:41918222-41918244 GGTCACCCACCACCTAAAATGGG - Intergenic
1184091034 22:42293150-42293172 GGCCCCCCAGCCCCTCGAATAGG + Intronic
1184644695 22:45889556-45889578 GGCCCCCCAACCCCCAGAGGAGG - Intergenic
1184830449 22:46982759-46982781 GTCCCGCCACCACCTAGTTTAGG - Intronic
949330475 3:2916788-2916810 GGCCCCCCACCTCCCAGACGGGG + Intronic
949853471 3:8440249-8440271 CGCCCCCCACCTCCCAGAGGGGG - Intergenic
949884657 3:8683579-8683601 GGCCTCCACCCACCCAGAGTAGG - Intronic
949896252 3:8769149-8769171 GGCACCCCACCACCTCCACTCGG + Intronic
953084920 3:39656053-39656075 GGCCCCCCACCTCCCAGACGGGG - Intergenic
953390651 3:42531877-42531899 ACCCTCCCACCACCTAGAGATGG + Intronic
953974404 3:47371406-47371428 GGCCCCCCAACCCCTAGGCTGGG + Intergenic
954214381 3:49116294-49116316 GGCCCCACACCACCTTCCGTTGG - Exonic
954566910 3:51607693-51607715 GGCCCCCCACCTCCCAGACGGGG + Intronic
954566942 3:51607770-51607792 GGCCCCCCACCTCCCAGATGGGG + Intronic
954880152 3:53829922-53829944 AACCCCCCACCACCCAAAGTTGG - Intronic
955076746 3:55621154-55621176 GCCCCCCCTCCAGCCAGAGTTGG + Intronic
955670034 3:61393531-61393553 CGCCCCCCACCACCCAGATGGGG + Intergenic
955875140 3:63481103-63481125 GCCCACTCACCACCTAGTGTGGG + Intronic
957044299 3:75362092-75362114 GGCCTCCACCCACCCAGAGTAGG + Intergenic
957076092 3:75604276-75604298 GGCCTCCACCCACCCAGAGTAGG + Intergenic
960577604 3:119242937-119242959 GGCCCCCCACCTCCCAGACGGGG - Intergenic
960950899 3:122997839-122997861 TGCCCCACACCACCCAGAGTGGG + Intronic
961272345 3:125698670-125698692 GGCCTCCACCCACCCAGAGTAGG - Intergenic
961275204 3:125720907-125720929 GGCCTCCACCCACCCAGAGTAGG - Intergenic
961278122 3:125743529-125743551 GGCCTCCACCCACCCAGAGTAGG - Intergenic
961876290 3:130026126-130026148 GGCCTCCACCCACCCAGAGTAGG + Intergenic
962318171 3:134371482-134371504 GGCCCCAGAGCACCTGGAGTGGG + Exonic
962788024 3:138785263-138785285 GCCCCCCCACCTCCTGGAGGGGG - Intronic
963776391 3:149445044-149445066 TGCCCCCCACCTCCCAGACTGGG + Intergenic
965890969 3:173513022-173513044 GGTCCCCCACCTCCCAAAGTGGG + Intronic
967141755 3:186567389-186567411 GGCCCCGCACCACCGAGACCTGG + Exonic
968156522 3:196385619-196385641 GGCTCCTCACCTCCCAGAGTGGG - Intronic
968955650 4:3717524-3717546 GGCCCTGCACCAACTAGAGTGGG + Intergenic
969713161 4:8855921-8855943 GGGACCCCACCACATTGAGTGGG - Intronic
969729570 4:8946189-8946211 GGCCTCCACCCACCCAGAGTAGG - Intergenic
969785734 4:9455719-9455741 GGCCTCCACCCACCCAGAGTAGG - Intergenic
975795927 4:78007192-78007214 TGCCCCCCACCTCCCAGAGGGGG + Intergenic
976149490 4:82078015-82078037 GGCCCCCCACCTCCCAGACAGGG - Intergenic
978535555 4:109758296-109758318 GGAACCCCACCACCTAGAGCAGG + Intronic
979941838 4:126771490-126771512 GGCCCCCCACCTCCCAGACGAGG - Intergenic
980750173 4:137077392-137077414 GGCCTCCCACTCCATAGAGTGGG - Intergenic
980999458 4:139814668-139814690 CTCCCCCCACCACCAAGACTTGG + Intronic
981994913 4:150964153-150964175 GGCCCCCCACCTCCCAGACGGGG - Intronic
983613719 4:169679039-169679061 CGCCCCCCACCTCCCAGACTGGG + Intronic
986613843 5:9596908-9596930 CTCCCCCCAGCACCTAGAGCAGG + Intergenic
989655738 5:43745760-43745782 GGCCCCCCACCTCCCAGATGGGG + Intergenic
993934776 5:93986389-93986411 CGCCCCCCACCTCCCAGAGGGGG - Intronic
997284018 5:132665493-132665515 GGACCCCCAGCACCTAGAGCAGG - Intergenic
999133086 5:149299422-149299444 GGCCCCCCACCACCTAGAGTTGG - Intronic
1004152508 6:13134145-13134167 TGCCCCCCACCTCCTGGAGGGGG - Intronic
1007450025 6:41935676-41935698 GGCCCACCCCCAGCTAGAGTTGG + Exonic
1007630359 6:43269956-43269978 GGCCCCCCCCCTCCTGGAGGGGG + Intronic
1008909828 6:56720940-56720962 GGCCCCCCACCCCCCAGACGGGG + Intronic
1017007579 6:150038633-150038655 AGCCCCACACCGGCTAGAGTCGG - Intergenic
1018268840 6:162054648-162054670 GGCATCCCAGCACCTAGAGGAGG + Intronic
1019428812 7:989135-989157 GGCCCCCCAGCACCTACAGCTGG + Exonic
1019705561 7:2495727-2495749 GCCCCCCGAACACCTACAGTCGG + Intergenic
1022318227 7:29264142-29264164 GGCCCCCCACCTCCCAGACGGGG - Intronic
1022318258 7:29264220-29264242 GGCCCCCCACCTCCCAGACGGGG - Intronic
1023659268 7:42456184-42456206 GGCCACCTTCCACCTTGAGTTGG + Intergenic
1029424695 7:100488430-100488452 GGGCCCCCACCCCCAAGAGGGGG - Exonic
1033090226 7:138378900-138378922 GGCCCCCCACCCCCCAGACGGGG + Intergenic
1034542807 7:151769821-151769843 GCACCCCCACCCCATAGAGTGGG + Intronic
1034773145 7:153799051-153799073 GGCCGCACACCTCCTAGAGGAGG - Intergenic
1035626831 8:1076944-1076966 GGCCCCCCAAGACCAAGAGGGGG + Intergenic
1036261949 8:7248192-7248214 GGCCTCCACCCACCCAGAGTAGG + Intergenic
1036313989 8:7706737-7706759 GGCCTCCACCCACCCAGAGTAGG + Intergenic
1036355491 8:8039352-8039374 GGCCTCCACCCACCCAGAGTAGG - Intergenic
1036833251 8:12038191-12038213 GGCCTCCACCCACCCAGAGTAGG + Intergenic
1036855098 8:12284756-12284778 GGCCTCCACCCACCCAGAGTAGG + Intergenic
1036903411 8:12688609-12688631 GGCCTCCACCCACCCAGAGTAGG + Intergenic
1037764248 8:21762202-21762224 GCCCCCTCACCACCAGGAGTGGG + Intronic
1038378943 8:27074137-27074159 AGCCCCACCCCACCTAGATTAGG + Intergenic
1044170966 8:89050602-89050624 GGCCCCCCACCACAGAGAAAAGG - Intergenic
1044637415 8:94340930-94340952 TGCCCCCCACCTCCTGGACTGGG - Intergenic
1045021858 8:98051697-98051719 GCCCCCCCACCTCCCAGACTGGG + Intergenic
1045322624 8:101093432-101093454 GGCCCCCCACCCCCTGGAGGAGG + Intergenic
1045489382 8:102656837-102656859 TGCCTCCCACCAGCTGGAGTGGG - Intergenic
1047445308 8:124913954-124913976 GGCCCCCTAGAACCTAGACTGGG - Intergenic
1049454965 8:142682123-142682145 GGCCCCCCAGAGCCTAGAGCTGG - Exonic
1049481580 8:142826961-142826983 GGCCCCCCACCTCCCAGACGGGG + Intergenic
1049975962 9:861689-861711 GGCCCCCCACCTCCCAGACGGGG + Intronic
1052274893 9:26664580-26664602 CGCCCCCCACCTCCCAGAGGGGG - Intergenic
1055580425 9:77702692-77702714 GGCCCCCCACCTCCCAGACGGGG + Intergenic
1056808301 9:89745235-89745257 GGCCCTCCCCCACTGAGAGTGGG - Intergenic
1056865940 9:90227465-90227487 GGCCTCCACCCACCCAGAGTAGG - Intergenic
1056917081 9:90755441-90755463 GGCCTCCACCCACCCAGAGTAGG + Intergenic
1057716165 9:97498078-97498100 TGCCCCCCACCTCCTGGAGGGGG + Intergenic
1058244112 9:102603263-102603285 GGCCCCCCACCTCCCAGACGGGG + Intergenic
1061205233 9:129159196-129159218 GGGCCCCCAGCACCAGGAGTAGG + Intergenic
1185652938 X:1661808-1661830 GGCCCACCACAGCCCAGAGTTGG + Intergenic
1189882038 X:45503844-45503866 GGCCCCCCACCTCCCAGAAGGGG + Intergenic
1191828762 X:65392653-65392675 GGCCCCCCACCCCCCAGATGGGG - Intronic
1196688169 X:118530436-118530458 GGCTCCCCATCACCTACACTAGG + Intronic