ID: 999134671

View in Genome Browser
Species Human (GRCh38)
Location 5:149310621-149310643
Sequence GGTCACGTATGTAAAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999134671_999134672 -3 Left 999134671 5:149310621-149310643 CCAAGAGCTTTACATACGTGACC 0: 1
1: 0
2: 2
3: 7
4: 109
Right 999134672 5:149310641-149310663 ACCTCATTTCTGCTTGAAAATGG No data
999134671_999134674 -2 Left 999134671 5:149310621-149310643 CCAAGAGCTTTACATACGTGACC 0: 1
1: 0
2: 2
3: 7
4: 109
Right 999134674 5:149310642-149310664 CCTCATTTCTGCTTGAAAATGGG 0: 1
1: 0
2: 2
3: 25
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999134671 Original CRISPR GGTCACGTATGTAAAGCTCT TGG (reversed) Intronic
902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG + Intronic
902561624 1:17281069-17281091 GGTCACGTGTGCAAAGCACATGG + Intronic
903190325 1:21652354-21652376 GTTCACGCACGTAAAGCGCTCGG + Intronic
903551372 1:24159246-24159268 GGTCATGTATGTGAAGCACTCGG - Intronic
906328164 1:44861746-44861768 GGTGACGGATGGAAAGCTGTGGG + Intronic
912558617 1:110534364-110534386 AGTCACATAAGTAAAGCACTAGG - Intergenic
914277750 1:146140428-146140450 GGTAACGTATGAAAATGTCTAGG - Intronic
914538796 1:148591376-148591398 GGTAACGTATGAAAATGTCTAGG - Intronic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
1072880079 10:99218021-99218043 GATCACCTTTGAAAAGCTCTTGG + Intronic
1076190860 10:128482466-128482488 GCTCATGTATGCAAAGCGCTTGG - Intergenic
1078845026 11:15112842-15112864 GGTCAAGGATGTAAAGCACCTGG - Intronic
1084178286 11:67434577-67434599 CGCCACGTATGTGAAGCCCTGGG - Exonic
1086094122 11:83033520-83033542 GATAAATTATGTAAAGCTCTTGG - Intronic
1086287732 11:85268600-85268622 GTTCACATGGGTAAAGCTCTAGG + Intronic
1086990924 11:93303418-93303440 GGTGGAGTATGTAAAGCTCCTGG - Intergenic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1089180676 11:116581039-116581061 GGTCGTGTTTGTAAAGCACTTGG + Intergenic
1091121075 11:133058081-133058103 GTTTACATTTGTAAAGCTCTTGG + Intronic
1091820305 12:3471018-3471040 TGACACGTGTCTAAAGCTCTAGG + Intronic
1092997457 12:13963551-13963573 GGTGAAGTATGTAAAGCGCCTGG - Intronic
1095598249 12:43983713-43983735 GATAACATATGTAAAGTTCTTGG - Intronic
1097440944 12:59607744-59607766 GATAAGGTATGAAAAGCTCTGGG - Intronic
1098363578 12:69679272-69679294 GATAACGTATATAAAGCACTTGG + Intronic
1101607122 12:106255890-106255912 GGTAACGTGTGTAAAGCTCCTGG - Intronic
1105544840 13:21343751-21343773 AGTAACGTACGTAAAGCTGTTGG - Intergenic
1106127919 13:26915738-26915760 GCTCACCTATGTAAAGTTCAGGG + Intergenic
1107197023 13:37664801-37664823 ATTCACATTTGTAAAGCTCTTGG - Intronic
1108987010 13:56604595-56604617 GGTCACGTAAGAATAGGTCTTGG + Intergenic
1110788455 13:79560797-79560819 TCCCAAGTATGTAAAGCTCTTGG - Intergenic
1113099791 13:106704697-106704719 AGTGAGGTGTGTAAAGCTCTGGG - Intergenic
1115862390 14:37701758-37701780 GATCATGTATGTAACACTCTGGG - Intronic
1116055623 14:39860938-39860960 GGTCATGTATGTAAAGCTCCTGG + Intergenic
1119999641 14:79288473-79288495 AGTCACATATGTAAAGCATTTGG - Intronic
1121340338 14:93101212-93101234 GGTCACACATGTAGAGCTTTGGG - Intronic
1128575688 15:68773165-68773187 GATCACATGTGTCAAGCTCTGGG + Intergenic
1128647731 15:69389413-69389435 GGTCATACATGTAAAGCCCTTGG + Intronic
1128837564 15:70823161-70823183 GGTCACTTATGTAAAGAGCGGGG - Intergenic
1136265838 16:29117554-29117576 GGTCAGGTGTGCAAAGCTGTTGG + Intergenic
1137714533 16:50590552-50590574 GCTCACATTTGTAAAGCGCTTGG - Intronic
1140103314 16:71937585-71937607 GATCATGTATGCAAAGCTATTGG + Intronic
1140356039 16:74307571-74307593 GGTCCTGTATGTAAGGCTCAGGG + Intergenic
1140429246 16:74887617-74887639 GGTTACATATGCACAGCTCTGGG + Intronic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1141848442 16:86627170-86627192 GGACATCTCTGTAAAGCTCTTGG + Intergenic
1144463121 17:15474144-15474166 GATCATGGATGTAAAACTCTTGG - Intronic
1150266085 17:63833254-63833276 GGACTCCTATGTAAAGCTCTGGG - Intronic
1151600392 17:75102585-75102607 GGGCAGGTTTGTAAAGCCCTCGG + Intronic
1156697641 18:39786336-39786358 GATCACGCATGTAAAGAACTCGG - Intergenic
1156716723 18:40021258-40021280 GGTCCAGTATGTAAAGAGCTTGG + Intergenic
1159185866 18:64973051-64973073 GATGACATATGTAAAGCACTAGG + Intergenic
926151626 2:10428703-10428725 GGTCACATATGCAAAGCGCATGG + Intergenic
928135300 2:28683281-28683303 GGTCACACATGAAGAGCTCTTGG + Intergenic
930834985 2:55783531-55783553 GTTTAGGTATTTAAAGCTCTTGG + Intergenic
932155973 2:69418008-69418030 GATAACATATGTAAAGCACTAGG + Intronic
932890343 2:75590485-75590507 CTTCAGGTATGTGAAGCTCTTGG + Intergenic
935055322 2:99561252-99561274 GATAGCGTTTGTAAAGCTCTTGG + Intronic
936864337 2:117059321-117059343 TTTCACTTGTGTAAAGCTCTGGG - Intergenic
937062056 2:118988123-118988145 GGTCATGGATGTAAAGCCCCTGG + Intronic
940961252 2:159788789-159788811 GGTCACTTTTGAAAAGTTCTTGG + Intronic
942771611 2:179527379-179527401 GGTCTCCTTTGAAAAGCTCTGGG + Intronic
943507240 2:188776792-188776814 TGTCAAGTGTGTAATGCTCTTGG + Intronic
946245936 2:218387443-218387465 GGTAACATATGTTAAGCACTTGG + Intronic
946841022 2:223820229-223820251 GGTCCCTTATGTAAATCACTGGG - Intronic
1172020463 20:31910189-31910211 GGTAACGCAGGTAAAGCACTTGG - Intronic
1173050107 20:39551048-39551070 GTTCAAGTATGTAAAGTGCTAGG - Intergenic
1178413674 21:32386716-32386738 TGTCATGTAAGTAAAGCTCTTGG - Intronic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1179615192 21:42579127-42579149 GGGCACGGAGTTAAAGCTCTGGG + Intronic
1184501378 22:44876179-44876201 CTTCTCGTATGTAAAACTCTTGG + Intergenic
949455118 3:4230094-4230116 AGTCACATTTGTAATGCTCTAGG - Intronic
952870719 3:37898557-37898579 GATCATGTGTGTAAAGCTCTTGG - Intronic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
964104056 3:153020675-153020697 GGTCACTAATGGAAAGGTCTAGG - Intergenic
968404272 4:326675-326697 GCTGAGGTATGTAAAGCTCCTGG - Intergenic
969605922 4:8202275-8202297 GGTCACGCCTGGAGAGCTCTGGG - Intronic
977088639 4:92639834-92639856 GATTACATATGTAAAGCACTTGG + Intronic
977440534 4:97060932-97060954 GGTAACATATGTAAAGATCCTGG + Intergenic
978930612 4:114306859-114306881 TGTCATTTATATAAAGCTCTAGG - Intergenic
984655372 4:182311660-182311682 GGTCATATATGTAAAGCACCTGG + Intronic
987396675 5:17430878-17430900 GGTCAAGTATGAACCGCTCTTGG + Intergenic
987546234 5:19314064-19314086 GGTCACGAAAGTAAAACCCTCGG - Intergenic
988907922 5:35809119-35809141 GGTCATGCATGTAAAGCACTTGG + Intronic
991143533 5:63274216-63274238 GCTGAAGTATGTAAAGCTCCTGG + Intergenic
995923124 5:117337767-117337789 AATTATGTATGTAAAGCTCTAGG + Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
997598744 5:135125190-135125212 GACTATGTATGTAAAGCTCTTGG + Intronic
998478786 5:142444074-142444096 GGTCTTATATGTAAAGCACTTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999134671 5:149310621-149310643 GGTCACGTATGTAAAGCTCTTGG - Intronic
1001285423 5:170419640-170419662 GATCACGTATATTAAGCACTTGG - Intronic
1004087401 6:12464174-12464196 GGTCACTTAGGGAAGGCTCTAGG - Intergenic
1007616555 6:43183000-43183022 GATCATGTATGTAAAGCACTTGG - Intronic
1011676542 6:89739967-89739989 GGTAACATATGTAAAGGGCTAGG + Intronic
1012142583 6:95642586-95642608 GGTGAAGTATGTAAAACTCCTGG - Intergenic
1014595871 6:123338092-123338114 GGTCTCCTATTTAAAGATCTTGG - Intronic
1015926677 6:138317139-138317161 GCTCACGTCTGTATAGCACTTGG + Intronic
1023031303 7:36092567-36092589 GGTCACCTATGTAAAGGGGTGGG - Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1026469906 7:70686264-70686286 ATTCATGTATGTAAAGCACTTGG - Intronic
1026883193 7:73920388-73920410 TGTCACCTATAAAAAGCTCTTGG + Intergenic
1029129458 7:98319006-98319028 GATAACGTATGTAAATCACTTGG + Intronic
1032578332 7:133079541-133079563 GGTAAGGTATGTAAAGCACCTGG - Intronic
1032735235 7:134686730-134686752 GGTTACATATGTCAAGGTCTAGG - Intergenic
1033450205 7:141455659-141455681 GTTAACATTTGTAAAGCTCTTGG + Intronic
1037316786 8:17606763-17606785 GGTCATGCGTGTAAACCTCTTGG + Intronic
1038390272 8:27191822-27191844 GGTAAGGTGTCTAAAGCTCTGGG - Intergenic
1045210248 8:100090146-100090168 GGTAACGTATGTTAAGCGCCTGG - Intronic
1046615225 8:116469936-116469958 GGTCACGTAGACAAAGCTTTTGG - Intergenic
1049748711 8:144273706-144273728 GATCACGTCTGTGAAGCTCCAGG + Intronic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1055333876 9:75212086-75212108 GATCATGTATGGAAAGCCCTAGG - Intergenic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1058541948 9:106020781-106020803 GATCACATATGTAAAGTTCCAGG + Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1188458763 X:30397678-30397700 GGACATGTATGTAATTCTCTTGG - Intergenic
1191826353 X:65369290-65369312 GATAACACATGTAAAGCTCTTGG - Intronic
1198995688 X:142571358-142571380 GCTCAGGTATCTAAAGCTCCCGG - Intergenic
1201634649 Y:16109090-16109112 AGTCACTTTTGTAAAGCTATTGG - Intergenic