ID: 999135227

View in Genome Browser
Species Human (GRCh38)
Location 5:149314219-149314241
Sequence CCTCACTTAGCCTTTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999135222_999135227 12 Left 999135222 5:149314184-149314206 CCCAGGTGGATGCAGGAGGAGAA 0: 1
1: 0
2: 5
3: 31
4: 444
Right 999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG 0: 1
1: 1
2: 1
3: 9
4: 157
999135223_999135227 11 Left 999135223 5:149314185-149314207 CCAGGTGGATGCAGGAGGAGAAG 0: 1
1: 1
2: 4
3: 42
4: 382
Right 999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG 0: 1
1: 1
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999135227 Original CRISPR CCTCACTTAGCCTTTGCCAT TGG Intronic
900647291 1:3714703-3714725 CCACACTCAGCCTCTGCCCTGGG - Intronic
902046056 1:13525438-13525460 TCACACTTAACCTTTGCCAAAGG + Intergenic
902227231 1:15004063-15004085 CCTCACTTTGTCTTTGACCTAGG - Intronic
902284060 1:15395021-15395043 CCGCACCCAGCCTTTCCCATAGG - Intronic
903472009 1:23593800-23593822 CCTCCCTCGGCCTTTCCCATGGG + Intronic
904893259 1:33795043-33795065 CCTCACCTAGACCTTGCTATAGG - Intronic
906184974 1:43855236-43855258 CTTCATTTAGCCTTTACAATGGG + Intronic
908087972 1:60657077-60657099 CCACACTTAGCACTTGTCATGGG - Intergenic
913073542 1:115322207-115322229 CCAGACTTAGCTTTTGCCATGGG - Intronic
913501014 1:119472790-119472812 CCTCACTTAGCCTTTCCAGTAGG + Intergenic
913563863 1:120050909-120050931 TCTGACTTATCCTTTGCTATGGG + Intronic
913634262 1:120742654-120742676 TCTGACTTATCCTTTGCTATGGG - Intergenic
914284457 1:146210283-146210305 TCTGACTTATCCTTTGCTATGGG + Intronic
914621079 1:149409649-149409671 TCTGACTTATCCTTTGCTATGGG - Intergenic
916056615 1:161072893-161072915 CCTGACTTGCCCTTTGCCCTTGG - Intronic
916847958 1:168672667-168672689 CCTCCCATACCCATTGCCATTGG + Intergenic
917239138 1:172928566-172928588 CCTTACTTTGAATTTGCCATTGG - Intergenic
918188404 1:182148221-182148243 CCTGCCTTAGCTTTTCCCATGGG + Intergenic
921335510 1:214081698-214081720 CCTCACTTAACGTTGTCCATAGG - Intergenic
922447687 1:225711353-225711375 CCTTACTCTGCCTTTTCCATAGG - Intergenic
924110567 1:240695532-240695554 CCTCACTTGGCCACTGCCATTGG + Intergenic
1065459966 10:25950177-25950199 CCTCAAATAGCCTTTTCCTTTGG - Intronic
1066388412 10:34959982-34960004 CCTCACTTCCCCTTTCCCAAGGG - Intergenic
1067046156 10:42986239-42986261 CCTCACTTCCCCTTGGCCAGGGG - Intergenic
1070315731 10:75310532-75310554 CCTCACTTAGCCTTTGCTACTGG - Intergenic
1073633296 10:105170768-105170790 ACTCACTTAGCCTTTGAAAGAGG - Intronic
1077521655 11:3039367-3039389 CCTCACTTAGAGTTGGCCAAGGG - Intronic
1078065002 11:8072404-8072426 CCTCACCAAGCCTGTGGCATGGG - Intronic
1080302546 11:30800425-30800447 CCTCACTTAACATTGTCCATAGG - Intergenic
1080953597 11:37066312-37066334 CATCAACTAGCCATTGCCATAGG + Intergenic
1083232207 11:61329952-61329974 CCTCACCTGGACATTGCCATGGG + Exonic
1083812147 11:65112090-65112112 CTTCGCTTAGCCTTTGCCCCAGG - Intronic
1087096704 11:94325997-94326019 CCTCACTTATCCTATGACAGAGG + Intergenic
1087476345 11:98640192-98640214 CCTCACTATGCATTTGTCATGGG - Intergenic
1088026229 11:105187009-105187031 CCACACTTAGCCTTTTACATGGG - Intergenic
1088794711 11:113258050-113258072 CCTCATCCAGCCTTAGCCATGGG + Intronic
1090088850 11:123675847-123675869 CCACACAGAGCCTTTGACATAGG - Intergenic
1092025277 12:5234567-5234589 CCTCACTCAGCCTCTTCCCTCGG + Intergenic
1092111912 12:5970208-5970230 ACTCACTGAGCCTTGGCCACTGG + Intronic
1093714016 12:22361020-22361042 CCTCACTCAGCCTTTGCTGAAGG + Intronic
1097540101 12:60931482-60931504 TCTCACTTAACCTTACCCATTGG + Intergenic
1101319658 12:103662460-103662482 CCTCACTTATGCTCTGCCTTTGG - Intronic
1103249645 12:119488589-119488611 TCTCATTTGGCCTTTGCAATGGG - Intronic
1105269738 13:18860959-18860981 TCTTACTTAGCTTTGGCCATAGG - Intergenic
1106917675 13:34532413-34532435 CCTCTCTTTGCCTCTGCCACTGG + Intergenic
1109313600 13:60723810-60723832 CCTCACTTGACTTTTTCCATTGG - Intergenic
1111406600 13:87814511-87814533 CATCCCTCAGGCTTTGCCATGGG + Intergenic
1116060672 14:39920689-39920711 GGTCAGTTAGCCTTTGCCCTAGG - Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1116897972 14:50335620-50335642 GCTCAATTAGCCTTTGTCAGTGG - Intronic
1118378201 14:65195344-65195366 CCTCACTTAACATTGTCCATAGG + Intergenic
1120008914 14:79390957-79390979 CCTCTCTTGCCCTTTGCCTTTGG + Intronic
1121242518 14:92440700-92440722 TCTCACTAAGCCCTTGACATTGG - Intronic
1122901130 14:104782737-104782759 CCTCACGTGGCCTTTGTCTTCGG + Intronic
1202829612 14_GL000009v2_random:12981-13003 TCTGACTTAGCTTTGGCCATAGG + Intergenic
1135102925 16:19622722-19622744 CCTCTCTTAGCCTTTTCCAAAGG + Intronic
1138225281 16:55289617-55289639 CCTCCCTCAGACTCTGCCATGGG + Intergenic
1143582095 17:7833618-7833640 CCTCACTCAGACTTTGACCTTGG + Exonic
1143721994 17:8818955-8818977 CCTTTCTGAGCCTTTGCTATTGG - Intronic
1146908483 17:36632947-36632969 CCGCACTTACCCTTTGCTCTAGG - Intergenic
1147157914 17:38553830-38553852 CCTCACTCTGCCCTTGCCAGAGG + Intronic
1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG + Exonic
1151076077 17:71274162-71274184 CCACACTTTGGCCTTGCCATTGG - Intergenic
1153020726 18:626432-626454 CCTGACTTTGCCTTTGCCTATGG - Intronic
1154418310 18:14199018-14199040 TCTGACTTAGCTTTGGCCATAGG + Intergenic
1154955913 18:21254497-21254519 CCTCCCTTAGCGTTTCCCAAAGG + Intronic
1155285725 18:24287336-24287358 CCTCTCTTGACCTTGGCCATAGG - Intronic
1156458697 18:37309066-37309088 CCCCACATACCCTTTGGCATGGG - Intronic
1157944704 18:51966121-51966143 CCTTACTAAGCCATTTCCATGGG - Intergenic
1159123111 18:64192833-64192855 CCCCATTTCTCCTTTGCCATTGG - Intergenic
1159869125 18:73740743-73740765 CCTCACTTAGATGTGGCCATGGG + Intergenic
1164901447 19:31929305-31929327 CTTCACTGAGTCTTTGCCCTTGG + Intergenic
1164908876 19:31989478-31989500 CCTGACTTAGCCTTTCCCTGTGG + Intergenic
1202643083 1_KI270706v1_random:114803-114825 TCTGACTTAGCTTTGGCCATAGG - Intergenic
926255512 2:11191854-11191876 CCTCACTTAACATTGTCCATAGG - Intronic
926307192 2:11646846-11646868 CCTCACTTACCCTTTGCCATGGG - Intergenic
927457174 2:23263100-23263122 TCTCACTTAGCATTATCCATAGG + Intergenic
934498955 2:94838276-94838298 TCTTACTTAGCTTTGGCCATAGG - Intergenic
935626878 2:105178926-105178948 CCTCTCTCAGCCTCTGCAATTGG - Intergenic
936757903 2:115736734-115736756 CATCGCTGAGCCTTTGACATAGG - Intronic
939218394 2:139270706-139270728 CCTCACTTGGCAGGTGCCATTGG + Intergenic
939374326 2:141344424-141344446 CCTCTCTTGGCCTTTGGCGTAGG + Intronic
939939938 2:148337105-148337127 CCTTTCTTAGCCTTTGTCTTTGG + Intronic
939985526 2:148826217-148826239 CCTCACTTGGCCTTTTGCCTAGG - Intergenic
940338728 2:152556969-152556991 CCTTGCTTAGGCTTTTCCATTGG - Intronic
943943490 2:194028977-194028999 CCCCACTTAGACCTTGCCCTAGG - Intergenic
946116618 2:217468334-217468356 CCAGACTTAGCCTCTGCCTTTGG - Intronic
946663818 2:222028836-222028858 CCTCACTTATCCCTGGGCATAGG + Intergenic
946885433 2:224217768-224217790 CCTCATTAAGCCTTGGCCATAGG + Intergenic
1169813160 20:9629426-9629448 CCTCACATAGCCTTTTCTCTGGG + Intronic
1171890202 20:30704999-30705021 TCTGACTTAGCTTTGGCCATAGG - Intergenic
1172176629 20:32976422-32976444 CCTCACTGTCCCTGTGCCATAGG + Intergenic
1176608796 21:8857822-8857844 TCTGACTTAGCTTTGGCCATAGG + Intergenic
1179436685 21:41367097-41367119 CCTCCCTTAGCCTTGGCCGTGGG - Intronic
1180358883 22:11867650-11867672 TCTGACTTAGCTTTGGCCATAGG + Intergenic
1181344758 22:22210914-22210936 CCTCCCTTGGCCCATGCCATAGG - Intergenic
1181959425 22:26612207-26612229 CCTCACTCTGCCCTTGGCATGGG - Intronic
949099003 3:120443-120465 TCCCACTTAGCCAATGCCATTGG + Intergenic
951246000 3:20342306-20342328 CCTGCCTTACCCTTTGCCTTAGG + Intergenic
954698668 3:52440649-52440671 TCTCTCTTTGCCTTTGCCTTGGG - Intronic
955992971 3:64648135-64648157 CCCCACTTACCCTATGTCATTGG - Intronic
956456258 3:69423302-69423324 CCACACTTAGCCTTTGCTCGAGG + Intronic
956663713 3:71622895-71622917 CCTCACATGGCCTTTTCCCTGGG - Intergenic
959497806 3:107071853-107071875 CCTCTCTTTTCCTCTGCCATAGG + Intergenic
959858607 3:111190779-111190801 CCTTACTTAGCCATTGCTAATGG - Intronic
960035413 3:113097591-113097613 CTTCACTCAGCCTTTCCCACAGG + Intergenic
961094165 3:124140584-124140606 GGTCATCTAGCCTTTGCCATGGG - Intronic
963035258 3:141020215-141020237 TCTGAGTTAGCCTCTGCCATTGG - Intergenic
969843040 4:9897578-9897600 CCACACTTTCCCTTTTCCATTGG - Intronic
970021501 4:11574473-11574495 CCTCACTCATTCTTTCCCATGGG + Intergenic
970287987 4:14539552-14539574 GCAGACTTAGCCTTTCCCATTGG + Intergenic
971329407 4:25670261-25670283 CCTCCCTTGGCCTTTTCCAGAGG - Intronic
971805239 4:31350300-31350322 ACTCTGTTGGCCTTTGCCATAGG + Intergenic
976478947 4:85516482-85516504 CCTCACTTAACATCTTCCATAGG - Intronic
977452178 4:97212628-97212650 CTTCACTTAGCATTGTCCATAGG - Intronic
979738033 4:124112922-124112944 CCCCACTCACCCTTTTCCATGGG - Intergenic
982442026 4:155447674-155447696 CCCCACTTGGCTTTTGCCATGGG - Intergenic
1202770454 4_GL000008v2_random:200701-200723 TCTGACTTAGCTTTGGCCATAGG - Intergenic
985987370 5:3527382-3527404 CCTCTCTTTGCATCTGCCATGGG - Intergenic
987195509 5:15522077-15522099 CCTCATTTAGGCATTCCCATGGG - Intronic
987853493 5:23387635-23387657 CCTCACTTAGCCCTTCCCTGAGG - Intergenic
990355393 5:54961590-54961612 TCCCACTTAGCCTTCACCATTGG + Intergenic
994632739 5:102306294-102306316 CCTCACTTAGGGTTGTCCATGGG + Intergenic
997777268 5:136621904-136621926 CCTCAGGTAGCCTTAGGCATTGG - Intergenic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
1003312332 6:4980493-4980515 CCTCACTTAGCATATGTCTTTGG + Intergenic
1004456335 6:15795221-15795243 TCTCTCTTAGCCTGAGCCATCGG - Intergenic
1005590329 6:27318218-27318240 CCTCTCTTAGACTTTGGCAGTGG - Intergenic
1006700854 6:35971975-35971997 CATCACATCCCCTTTGCCATGGG + Intronic
1009578432 6:65497688-65497710 CCTCACTTAACTTTGTCCATAGG + Intronic
1013269280 6:108530791-108530813 GCTCACACAGCATTTGCCATGGG - Intergenic
1016580524 6:145624517-145624539 CCTGACTTATCCTTTACCTTTGG + Intronic
1018261571 6:161975772-161975794 ACTCACTTTGCCTCTGACATTGG - Intronic
1018912394 6:168109430-168109452 CCTCACTTTACCTTTTCTATGGG + Intergenic
1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG + Intronic
1026373978 7:69731496-69731518 ACTTACTTAGCATTTGCTATGGG - Intronic
1027480390 7:78688292-78688314 TCTCACTTAGCCTTTGGCTGAGG + Intronic
1028455213 7:91030889-91030911 TCTCACCTAGCCTTAGCCAGAGG - Intronic
1030759366 7:113331860-113331882 CCTAACTCATCCTTTCCCATTGG + Intergenic
1032310654 7:130783417-130783439 CTTCACTTAGCCTCTGCCAGTGG + Intergenic
1032345339 7:131110944-131110966 CCTCCCTTGCCCTTTGCCACAGG + Intronic
1034522180 7:151629006-151629028 CCTCACTGTGCCTGTGCCTTAGG - Intronic
1035874711 8:3175609-3175631 CCTGAGGTTGCCTTTGCCATGGG + Intronic
1040108618 8:43555210-43555232 CCTCACTCAGGCTCTCCCATGGG - Intergenic
1040388201 8:46928300-46928322 CCTCATCTGGCCTCTGCCATTGG + Intergenic
1042774806 8:72418842-72418864 CCTCACAAAGTCTGTGCCATGGG - Intergenic
1043771376 8:84205953-84205975 CCTCACTTGGCCTTTCCTGTGGG + Intronic
1043777751 8:84291306-84291328 GCCCACTTAGAATTTGCCATAGG + Intronic
1044743947 8:95354345-95354367 CCTCAAGAAGCTTTTGCCATGGG - Intergenic
1048578675 8:135712981-135713003 CCTTTCTTAGCCTTGGACATAGG + Intergenic
1051103867 9:13554939-13554961 CCTCACCTAGGCTTTGGCAAAGG + Intergenic
1052045692 9:23791695-23791717 CCTCACTTAGCTTTTACTCTGGG - Intronic
1053908574 9:42871554-42871576 TCTTACTTAGCTTTGGCCATAGG + Intergenic
1055249613 9:74287248-74287270 CACCACCTTGCCTTTGCCATAGG + Intergenic
1056090114 9:83197030-83197052 TCTGTCTTGGCCTTTGCCATGGG - Intergenic
1057459511 9:95246957-95246979 CGTGACTTTGCCTTTGACATTGG - Intronic
1203704192 Un_KI270742v1:23045-23067 TCTGACTTAGCTTTGGCCATAGG + Intergenic
1203559806 Un_KI270744v1:42780-42802 TCTGACTTAGCTTTGGCCATAGG - Intergenic
1186528685 X:10273658-10273680 CCTCACTTAGCATTGTCGATAGG + Intergenic
1187808828 X:23153089-23153111 CCTCACGTAGCCTTCTCCTTGGG + Intergenic
1188430524 X:30101778-30101800 CCTCTTTCAGACTTTGCCATAGG + Intergenic
1189734504 X:44055995-44056017 CCTCACTTAGCTTTAGCGTTGGG - Intergenic
1190076893 X:47323382-47323404 CCTCACTTAACATTCTCCATAGG - Intergenic
1192575032 X:72236834-72236856 CCTCACTTAACATTGTCCATAGG - Intronic
1194710597 X:97232162-97232184 CCTCACATAGCCCTTGCCTCTGG + Intronic
1199208883 X:145182799-145182821 CCTCACTTAGCCTGTGTTAATGG - Intergenic
1199541661 X:148964630-148964652 CCCCATTTACCCTTTGCCTTAGG - Intronic
1199815521 X:151393711-151393733 CCACACAGAGCCGTTGCCATGGG - Intergenic
1199917838 X:152363455-152363477 CCTCAATTAGTCTTTGCCTGTGG - Intronic