ID: 999135526

View in Genome Browser
Species Human (GRCh38)
Location 5:149316269-149316291
Sequence GACGTCCTCCACCGAGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999135522_999135526 -10 Left 999135522 5:149316256-149316278 CCGATGACCTGCAGACGTCCTCC 0: 1
1: 0
2: 1
3: 3
4: 162
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
999135521_999135526 8 Left 999135521 5:149316238-149316260 CCAAGAAGAAGACACTGGCCGAT 0: 1
1: 0
2: 4
3: 33
4: 348
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
999135519_999135526 25 Left 999135519 5:149316221-149316243 CCGTATCATTGGCTTCTCCAAGA 0: 1
1: 0
2: 1
3: 12
4: 155
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
999135518_999135526 26 Left 999135518 5:149316220-149316242 CCCGTATCATTGGCTTCTCCAAG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999135526 Original CRISPR GACGTCCTCCACCGAGGAGG AGG Exonic
900645929 1:3708755-3708777 CCCCTCCTGCACCGAGGAGGGGG + Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
906690483 1:47789612-47789634 GAAGTCATCCACAGAGGAAGAGG - Intronic
910930601 1:92439497-92439519 GAGGTCATCCACCCAGGAAGTGG + Intergenic
915463630 1:156083201-156083223 GACCCCCTCCACCGAGCAGAAGG - Intronic
915821648 1:159030758-159030780 GTTGTCCTCCAGCCAGGAGGTGG + Intronic
917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG + Exonic
921762843 1:218937092-218937114 GATGGCCTCCAGCCAGGAGGTGG + Intergenic
1070311494 10:75276649-75276671 GCCCTTCTCCACCGAGCAGGTGG + Intergenic
1070990808 10:80730624-80730646 GAAATGCTCCACAGAGGAGGTGG - Intergenic
1076325426 10:129616860-129616882 CACCTCCTCCCCCGAGGAGGTGG + Intronic
1081703557 11:45166756-45166778 GAAGTCCTCCAGGAAGGAGGTGG - Intronic
1083617863 11:64035500-64035522 GCCAACCTCCACCGTGGAGGCGG - Intronic
1084207937 11:67606819-67606841 TCAGTCCTCCCCCGAGGAGGCGG + Intergenic
1089624731 11:119743890-119743912 GAAGTCCCACAGCGAGGAGGTGG + Intergenic
1090274581 11:125410409-125410431 GTTGTCCTCCACCGAGGGAGGGG + Intronic
1095561565 12:43572076-43572098 GGCGTACTCCCCTGAGGAGGCGG - Intergenic
1097563057 12:61232623-61232645 AACCTCCACCATCGAGGAGGAGG - Intergenic
1101544391 12:105697921-105697943 GTTGGCCTCCACCCAGGAGGTGG + Intergenic
1108532926 13:51344366-51344388 GACGTGCTCCACAAAGCAGGGGG - Exonic
1116180504 14:41526248-41526270 GGCATGCTCCACCCAGGAGGTGG + Intergenic
1116822008 14:49635111-49635133 CAAGTCCTCCAGCGACGAGGAGG + Exonic
1128582082 15:68817832-68817854 GACGGCCTCCCGCGCGGAGGAGG - Intronic
1130898131 15:88186468-88186490 GACCTACTCAACGGAGGAGGTGG - Intronic
1132211060 15:100022305-100022327 GGGGTCCACCGCCGAGGAGGAGG - Intronic
1140899602 16:79355561-79355583 GACGTTCTCCATGGAAGAGGAGG - Intergenic
1142067171 16:88069205-88069227 GAGTTGCTGCACCGAGGAGGAGG - Intronic
1142129422 16:88425941-88425963 GACTGCCTGCACCGGGGAGGAGG - Intergenic
1143165065 17:4893502-4893524 CTCGTCGTCCAGCGAGGAGGTGG + Exonic
1143333441 17:6155210-6155232 GAGCTCCTCCACGGAGGAGGCGG + Intergenic
1144342957 17:14325430-14325452 GACTTCTTCCACTGAGTAGGAGG + Intronic
1145971597 17:28959569-28959591 GGCTTCCTCCAAGGAGGAGGTGG - Intronic
1148697596 17:49570513-49570535 CACGTCCTCACCCCAGGAGGCGG + Intergenic
1151410750 17:73926595-73926617 TGCGTCCTCCACCGAGGAGCTGG + Intergenic
1151848425 17:76674503-76674525 GACACCCACCACCGAGGAAGAGG + Exonic
1160755167 19:753110-753132 GGCGGCGTCCACGGAGGAGGAGG + Intronic
1160976665 19:1796227-1796249 GGCGGCCTCCCCCGACGAGGGGG - Exonic
1161383240 19:3977522-3977544 GACGCCATCCACCGCGGAGGGGG - Exonic
1161511818 19:4676285-4676307 GACCTCCTCCTCCCAGAAGGCGG + Exonic
1161596017 19:5151363-5151385 GGCCTCCTCCCCCGAGAAGGCGG - Exonic
1161723514 19:5916061-5916083 GAGGTCCTCGCCCGGGGAGGTGG + Exonic
1165496116 19:36152582-36152604 TTCGTCCACCACGGAGGAGGCGG + Exonic
1167740726 19:51323591-51323613 GGCTTCCCCCACCGAGGGGGTGG - Intronic
1167794774 19:51702318-51702340 GGTGTATTCCACCGAGGAGGCGG - Intergenic
1168694342 19:58396262-58396284 GAGGCACTCCACCGGGGAGGCGG - Exonic
925441862 2:3895072-3895094 GTTGTCCTCCAACCAGGAGGTGG + Intergenic
928472963 2:31592219-31592241 GATGGCCTCCAGCCAGGAGGTGG - Intergenic
933131222 2:78676396-78676418 CACGTCCTCCATTAAGGAGGTGG - Intergenic
934978797 2:98823486-98823508 GACGTGCACCCCAGAGGAGGAGG - Exonic
936503864 2:113088903-113088925 GAAGACCTCCAAGGAGGAGGTGG + Intergenic
936701103 2:115012351-115012373 GTCGGCCTCCAGCCAGGAGGTGG - Intronic
942754178 2:179319814-179319836 GAGGTCCTTCACGGAGGTGGGGG - Intergenic
943903983 2:193474661-193474683 GAAGTCCTCCACTGGGGATGGGG + Intergenic
948673222 2:239581833-239581855 AAGGTCCCCCACCGAGGAGGAGG - Intronic
1168943879 20:1735751-1735773 GACGTCGCCCACCCGGGAGGAGG + Intergenic
1169458112 20:5770413-5770435 CATGTCCTCCACAGAGGAAGAGG - Intronic
1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG + Intronic
1174453769 20:50635876-50635898 GACCTCCTCCAGCGGGGAAGAGG + Intronic
1176075032 20:63244511-63244533 GGCTTGCTCCACAGAGGAGGAGG - Intronic
1178855291 21:36245550-36245572 GTCGTTCTCCAGCGACGAGGAGG + Exonic
954752998 3:52824142-52824164 GACGTGCTGCACAGGGGAGGCGG - Intronic
961371200 3:126433114-126433136 GATGTCCATCACCAAGGAGGAGG + Exonic
965619971 3:170633580-170633602 CAGGTCCAGCACCGAGGAGGTGG + Intronic
966677334 3:182603396-182603418 GAATTGCTCCACCCAGGAGGTGG + Intergenic
967849234 3:194070224-194070246 GAAGACTTCCACAGAGGAGGTGG + Intergenic
968944825 4:3658211-3658233 GCCTTCCTCCACCGAGGAGCCGG + Intergenic
969053576 4:4388166-4388188 GACTTGCCCCACCGAGGCGGGGG + Intronic
975250671 4:72174706-72174728 GAAGTCCTCCTCTGTGGAGGAGG - Intergenic
975590053 4:75990748-75990770 GCCGGCCTACATCGAGGAGGTGG - Exonic
977976081 4:103268611-103268633 GTCGGCCTCCAGCCAGGAGGTGG + Intergenic
981958882 4:150511553-150511575 AACGTGCACCACCAAGGAGGTGG + Intronic
982299476 4:153864774-153864796 GATGGCCTCCAGCCAGGAGGTGG + Intergenic
986288017 5:6374903-6374925 AAGCTCCTCCACAGAGGAGGAGG - Intronic
987621905 5:20345850-20345872 GAAGTCCTCCACTGCGGACGGGG + Intronic
990005414 5:50939181-50939203 GTTGTCCTCCAGCCAGGAGGTGG - Intergenic
990253724 5:53943361-53943383 GAGGTCATCCACTGAGAAGGTGG + Intronic
992341762 5:75831769-75831791 CAAGTCCTCCATCCAGGAGGCGG - Intergenic
999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG + Exonic
1000352518 5:160363047-160363069 GTCCTCCTCCACCAAGGATGAGG - Intronic
1002634444 5:180600160-180600182 GACGTCTTTCACCGAGAAGGAGG - Intergenic
1002861907 6:1086739-1086761 CACATCCTCCTTCGAGGAGGCGG + Intergenic
1006437922 6:34035923-34035945 GAAGTCCACCACCGAGTGGGAGG + Exonic
1007836104 6:44674911-44674933 GCTGTCCTCCAGGGAGGAGGTGG - Intergenic
1009866959 6:69409406-69409428 GTTGGCCTCCAGCGAGGAGGTGG - Intergenic
1013460727 6:110372694-110372716 GAACTCCTCCACTGAGGCGGAGG - Intergenic
1018596775 6:165489115-165489137 GTTGTCCTCCAGCCAGGAGGTGG - Intronic
1018755328 6:166843438-166843460 GTTGTCCTCCAGCCAGGAGGTGG - Intronic
1019465434 7:1185608-1185630 AAAGTCCTCCACGGAGGGGGAGG - Intergenic
1019619014 7:1980429-1980451 TACGTCCCCCAGAGAGGAGGCGG - Intronic
1023414560 7:39919821-39919843 GACGAGCTCCACCGAGCAAGAGG + Intergenic
1023905975 7:44521794-44521816 GAAGTCATCCACCCAGGAGGAGG + Exonic
1026655980 7:72256923-72256945 CACATCCTCCTCCCAGGAGGTGG + Intronic
1028551284 7:92069335-92069357 GACTTTCTCCACCTAGGAAGAGG - Intronic
1028819574 7:95190646-95190668 GTCGGCCTCCATCCAGGAGGTGG + Intronic
1034560888 7:151878332-151878354 GACTCCCTCCCCAGAGGAGGAGG + Intergenic
1035291778 7:157844006-157844028 GACCCCCTGCACGGAGGAGGGGG + Intronic
1036425347 8:8640571-8640593 GACAGCTTCCACGGAGGAGGAGG + Intergenic
1038038694 8:23706551-23706573 GATGTCCTTGACCGAGAAGGGGG + Exonic
1049319014 8:141986055-141986077 GACTCCATCCACCGAGGAGTGGG + Intergenic
1049710528 8:144061002-144061024 GACGTCCTTCCCCGTGGAGGGGG + Intronic
1051273243 9:15375102-15375124 GATGGCCTCCAACCAGGAGGTGG - Intergenic
1057062701 9:92019830-92019852 GAGGCCCTGCACTGAGGAGGGGG + Intergenic
1057352185 9:94308215-94308237 GAGGTCCTGAACCCAGGAGGCGG + Intergenic
1057655457 9:96947875-96947897 GAGGTCCTGAACCCAGGAGGCGG - Intronic
1062253971 9:135612500-135612522 GACATCCTGCACCCAGAAGGAGG + Intergenic
1188709055 X:33371634-33371656 GTTGGCCTCCACCCAGGAGGTGG + Intergenic
1188924208 X:36019377-36019399 GACCTCCTCCCCCGAGTAGGAGG + Intergenic
1190739897 X:53281707-53281729 GAACTCCTCCTCCGAGGAAGCGG + Intronic
1201555143 Y:15259308-15259330 GACTTCTTCCACGCAGGAGGGGG + Intergenic