ID: 999135526

View in Genome Browser
Species Human (GRCh38)
Location 5:149316269-149316291
Sequence GACGTCCTCCACCGAGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999135522_999135526 -10 Left 999135522 5:149316256-149316278 CCGATGACCTGCAGACGTCCTCC 0: 1
1: 0
2: 1
3: 3
4: 162
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
999135518_999135526 26 Left 999135518 5:149316220-149316242 CCCGTATCATTGGCTTCTCCAAG 0: 1
1: 0
2: 0
3: 12
4: 150
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
999135519_999135526 25 Left 999135519 5:149316221-149316243 CCGTATCATTGGCTTCTCCAAGA 0: 1
1: 0
2: 1
3: 12
4: 155
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98
999135521_999135526 8 Left 999135521 5:149316238-149316260 CCAAGAAGAAGACACTGGCCGAT 0: 1
1: 0
2: 4
3: 33
4: 348
Right 999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999135526 Original CRISPR GACGTCCTCCACCGAGGAGG AGG Exonic