ID: 999138721

View in Genome Browser
Species Human (GRCh38)
Location 5:149342464-149342486
Sequence TTCTGAATGTTGCAGTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999138721_999138723 16 Left 999138721 5:149342464-149342486 CCCTTGTACTGCAACATTCAGAA No data
Right 999138723 5:149342503-149342525 TAAATAGACGAATGAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999138721 Original CRISPR TTCTGAATGTTGCAGTACAA GGG (reversed) Intergenic
No off target data available for this crispr